2004 Newsletter Archives Subscribe to the C-R-Newsletter!
Note: The Center for Responsible Nanotechnology is an affiliate of World Care, an international, non-profit, 501(c)(3) organization. The opinions expressed by CRN in our newsletters and elsewhere do not necessarily reflect those of World Care.
#15 (January 13)
#16 (February 25)
#17 (March 25)
#18 (April 29)
#19 (May 25)
#20 (June 30)
#21 (July 31)
#22 (August 31)
#23 (September 29)
#24 (November 4)
#25 (December 2)2003 Archives
2005 Archives
2006 Archives
2007 Archives
2008 Archives
C-R-Newsletter #25 December 2, 2004
CONTENTS
Wise-Nano Update
On the Air in Australia
International Congress of Nanotechnology
Innovation, Opportunity, and Commercialization
World Social Forum
Contributions Needed for Conferences
From CRN’s Blog
Feature Essay: Planar Assembly—A better
way to build large nano-products
——————
Wise-Nano Update
The Wise-Nano.org website continues to
grow, with 65 users and over 100 pages (plus category pages). People are coming
along and adding pages spontaneously. It's exciting to see it start to expand.
For those just joining us, Wise-Nano is a CRN-hosted project, but it is not
controlled by CRN. It's a "Wiki" website, meaning that anyone can create or
improve articles. Stop by and give it a try! If you register, you can be notified
by email when a page you're interested in changes.
Somewhere on Chris's long list of pending tasks is a software upgrade with
several new features. We'll keep you posted as those are implemented.
On the Air in Australia
Chris was interviewed for a "Background Briefing" radio program in Australia,
a Sunday morning show with many thousands of listeners. The show was called "Nanotechnology:
Nature's Toy Box." They've posted a transcript of
the show, and streaming audio will be available from this
page for another few weeks.
The show included quite a few nanotech commentators and researchers. Chris’s
comments were used in three places. He explained how a nanofactory might
be used; warned of geopolitical instability from the rapidly decreasing difficulty
of developing molecular manufacturing; and discussed
the reasons why "grey goo" became such a notorious
concern.
International Congress of Nanotechnology
In early November, Mike traveled to San Francisco to make a presentation at
the International Congress of Nanotechnology.
His speech was titled "Building Bridges to Safety and Bridges to Progress." This
was a good opportunity to talk with people involved in research and development
of nanoscale technologies as well as some who are working on possible regulatory
questions of nanotech, including Congressman Mike Honda (D-CA).
Innovation, Opportunity, and Commercialization
After returning from San Francisco, Mike went to a conference at
Rensselaer Polytechnic Institute in Troy, New York, to give a talk called "Jolt
to the System: The Transformative Impact of Nanotechnology." As a result
of this presentation, Mike has been asked to speak at the next World
Future Society Annual Conference, being held July 29-31, 2005, in Chicago.
World Social Forum
At the end of January, Mike will return to Brazil to attend the World
Social Forum, which is described as an open meeting place of groups
and movements of civil society engaged in building a planetary society centered
on the human person. Mike’s purpose in attending is to present a balanced
view of nanotechnology as a source of 1) opportunity for developing nations
and their citizens, and 2) potentially serious problems that must be addressed.
Contributions Needed for Conferences
Can you help CRN attend conferences where we present our ideas and network
with influential people? Your tax-deductible* financial contributions can
go a long way toward defraying the significant costs we face. If you believe
in our mission, please support
us — Thank you!
* CRN is a program of World Care, an international, non-profit, 501(c)(3)
organization. To the extent allowed by law within your jurisdiction, donations
to CRN are tax deductible. Please consult your personal financial advisor
for prerequisites regarding your tax situation.
From CRN’s Blog
Mechanical Engineering magazine was cautiously positive toward molecular manufacturing
in its September nanotechnology special issue. Surprisingly, that
post has received no comments. Perhaps Chris wrote it too long. But
darn it, there was so much to say! The magazine builds a case that mechanical
engineers are well suited to develop nanotechnology--or will be, if they're
properly trained in nanoscale phenomena. And the main article closes with
a recommendation that they also be trained in ethics. Much of what they
wrote applies equally to nanoscale technologies and molecular manufacturing.
By contrast, Chris's next
post on "Peak Oil" drew 54 comments. Peak oil is the idea that oil prices
will rise steeply, not when we run out, but when supply drops below demand—and
it's currently within about 1%. If the line is crossed in the next few years,
molecular manufacturing could be the best way to rebuild our infrastructures.
Not that it would be developed for that purpose—the system is not
that foresighted. But if it were available, it could probably do the job—and
not much else can.
Feature Essay: Planar Assembly—A better way to
build large nano-products
by Chris Phoenix, CRN Director of Research
This month's essay is adapted from a
paper I wrote recently for my NIAC
grant, explaining why planar assembly, a new way to build large products
from nano-sized building blocks, is better and simpler than convergent
assembly.
History
Molecular manufacturing promises to build large quantities of nano-structured
material, quickly and cheaply. However, achieving this requires very small
machines, which implies that the parts produced will also be small. Combining
sub-micron parts into kilogram-scale machines will not be trivial.
In Engines of Creation (1986), Drexler
suggested that large products could be built by self-contained micron-scale "assembler" units
that would combine into a scaffold, take raw materials and fuel from a special
fluid, build the product around themselves, and then exit the product, presumably
filling in the holes as they left. This would require a lot of functionality
to be designed into each assembler, and a lot of software to be written.
In Nanosystems (1992), Drexler developed a simpler idea: convergent assembly.
Molecular parts would be fabricated by mechanosynthesis, then placed on assembly
lines, where they would be combined into small assemblages. Each assemblage
would move to a larger line, where it would be combined with others to make
still larger concretions, and so on until a kilogram-scale product was built.
This would probably be a lot simpler than the self-powered scaffolding of
Engines, but implementing automated assembly at many different scales for
many different assemblages would still be difficult.
In 1997, Ralph Merkle published a
paper, "Convergent Assembly", suggesting that the parts to be assembled
could have a simple, perhaps even cubical shape. This would make the assembly
automation significantly less complex. In 2003, I published a very
long paper analyzing many operational and architectural details of
a kilogram-per-hour nanofactory. However, despite 80 pages of detail,
my factory was limited to joining cubes to make larger cubes. This imposed
severe limits on the products it could produce.
In 2004, a collaboration between Drexler and former engineer John Burch resulted
in the resurrection of an idea that was touched on in Nanosystems: instead
of joining small parts to make bigger parts through several levels, add
small parts directly to a surface of the full-sized product, extruding
the product [38 MB movie] from the assembly plane. It turns out that
this does not take as long as you'd expect; in fact, the speed of deposition
(about a meter per hour) should not depend on the size of the parts, even
for parts as small as a micron in size.
Problems with Earlier Methods
In studying molecular manufacturing, it is common to find that problems are
easier to solve than they initially appeared. Convergent assembly requires
robotics in a wide range of scales. It also needs a large volume of space
for the growing parts to move through. In a simple cube-stacking design, every
large component must be divisible along cube boundaries. This imposes constraints
on either the design or the placement of the component relative to the cube
matrix.
Another set of problems comes from the need to handle only cubes. Long skinny
components have to be made in sections and joined together, and supported
within each cube. Furthermore, each face of each cube must be stiff, so as
to be joined to the adjacent cube. This means that products will be built
solid: shells or flimsy structures would require interior scaffolding.
If shapes other than cubes are used, assembly complexity quickly increases,
until a nanofactory might require many times more programming and design than
a modern "lights-out" factory.
However, planar assembly bypasses all these problems.
Planar Assembly
The idea of planar assembly is to take small modules, all roughly the same
size, and attach them to a planar work surface, the working plane of the product
under construction. In some ways, this is similar to the concept of 3D inkjet-style
prototyping, except that there are billions of inkjets, and instead of ink
droplets, each particle would be molecularly precise and could be full of
intricate machinery. Also, instead of being sprayed, they would be transported
to the workpiece in precise and controlled trajectories. Finally, the workpiece
(including any subpieces) would be gripped at the growing face instead of
requiring external support.
Small modules supplied by any of a variety of fabrication technologies would
be delivered to the assembly plane. The modules would all be of a size to
be handled by a single scale of robotic placement machinery. This machinery
would attach them to the face of a product being extruded from the assembly
plane. The newly attached modules would be held in place until yet newer modules
were attached. Thus, the entire face under construction serves as a "handle" for
the growing product. If blocks are placed face-first, they will form tight
parallel-walled holes, making it hard to place additional blocks; but if the
blocks are placed corner-first, they will form pyramid-shaped holes for subsequent
blocks to be placed into. Depending on fastening method, this may increase
tolerance of imprecision and positional variance in placement.
The speed of this method is counterintuitive; one would expect that the speed
of extrusion would decrease as the module size decreased. But in fact, the
speed remains constant. For every factor of module size decrease, the number
of placement mechanisms that can fit in an area increases as the square of
that factor, and the operation speed increases by the same factor. These balance
the factor-cubed increase in number of modules to be placed. This analysis
breaks down if the modules are made small enough that the placement mechanism
cannot scale down along with the modules. However, sub-micron kinematic systems
are already being built via both MEMS and biochemistry, and robotics built
by molecular manufacturing should be better. This indicates that sub-micron
modules can be handled.
Advantages of Planar Assembly
This approach requires only one level of modularity from nanosystems to human-scale
products, so it is simpler to design. Blocks (modules) built by a single fabrication
system can be as complex as that system can be programmed to produce. Whether
the feedstock producing system uses direct covalent deposition or guided self-assembly
to build the nanoblocks, the programmable feature size will be sub-nanometer
to a few nanometers. Since a single fabrication system can produce blocks
larger than 100 nanometers, a fair amount of complexity (several motors and
linkages, a sensor array, or a small CPU) could be included in a single module.
Programmable, or at least parameterized, (or at worst case, limited-type)
modules would then be aggregated into large systems and "smart materials".
Because of the molecular precision of the nanoblocks, and because of the inter-nanoblock
connection, these large-scale and multi-scale components could be designed
without having to worry about large-scale divisions and fasteners, which are
a significant issue in the convergent assembly approach (and also in contemporary
manufacturing).
Support of large structures will be much easier in planar assembly than in
convergent assembly. In simplistic block-based convergent assembly, each structure
(or cleaved subpart thereof) must be embedded in a block. This makes it impossible
to build a long thin structure that is not supported along each segment of
its length, at least by scaffolding.
In planar assembly, such a structure can be extruded and held at the base
even if it is not held anywhere else along its length. The only constraint
is the strength of the holding mechanism vs. the forces (vibration and gravity)
acting on the system; these forces are proportional to the cube of size, and
rapidly become negligible at smaller scales. In addition, the part that must
be positioned most precisely—the assembly plane—is also the part
that is held. Positional variance at the end of floppy structures usually
will not matter, since nothing is being done there; in the rare cases where
it is a problem, collapsible scaffolds or guy wires can be used. (The temporary
scaffolds used in 3D prototyping have to be removed after manufacture, so
are not the best design for a fully automated system.)
This indicates that large open-work structures can be built with this method.
Unfolding becomes much less of an issue when the product is allowed to have
major gaps and dangling structures. The only limit on this is that extrusion
speed is not improved by sparse structures, so low-density structures will
take longer to build than if built using convergent assembly.
Surface assembly of sub-micron blocks places a major stage of product assembly
in a very convenient realm of physics. Mass is not high enough to make inertia,
gravity, or vibration a serious problem. (The mass of a one-micron cube is
about a picogram, which under 100 G acceleration would experience a nanoNewton
of force. This is comparable to the force required to detach 1 square nanometer
of van der Waals adhesion (tensile strength 1 GPa, Nanosystems 9.7.1). Resonant
frequencies will be on the order of MHz, which is easy to isolate/damp.) Stiffness,
which scales adversely with size, is significantly better than at the nanoscale.
Surface forces are also not a problem: large enough to be convenient for handling—instead
of grippers, just put things in place and they will stick—but small
enough that surfaces can easily be separated by machinery. (The problems posed
by surface forces in MEMS manipulation are greatly exacerbated by the crudity
of surfaces and actuation in current technology. Nanometer-scale actuators
can easily modulate or supplement surface forces to allow convenient attachment
and release.)
Sub-micron blocks are large enough to contain thousands or even millions of
features: dozens to thousands of moving parts. But they are small enough to
be built directly out of molecules, benefiting from the inherent precision
of this approach as well as nanoscale properties including superlubricity.
If blocks can be assembled from smaller parts, then block fabrication speed
can improve.
Centimeter-scale products can benefit from the ability to directly build large-scale
structures, as well as the fine-grained nature of the building blocks (note
that a typical human cell is 10,000-20,000 nm wide). For most purposes, the
building blocks can be thought of as a continuous smooth material. Partial
blocks can be placed to make the surfaces smoother—molecularly smooth,
except perhaps for joints and crystal atomic layer steps.
Modular Design Constraints
Although there is room for some variability in the size and shape of blocks,
they will be constrained by the need to handle them with single-sized machinery.
A multi-micron monolithic subsystem would not be buildable with this manufacturing
system: it would have to be built in pieces and assembled by simple manipulation,
preferably mere placement. The "expanding ridge joint" system, described
in my Nanofactory
paper, appears to work for both strong mechanical joints and a variety
of functional joints.
Human-scale product features will be far too large to be bothered by sub-micron
grain boundaries. Functions that benefit from miniaturization (due to scaling
laws) can be built within a single block. Even at the micron scale, where
these constraints may be most troublesome, the remaining design space is a
vast improvement over what we can achieve today or through existing technology
roadmaps.
Sliding motion over a curved unlubricated surface will not work well if the
surface is composed of blocks with 90 degree corners, no matter how small
they are. However, there are several approaches that can mitigate this problem.
First, there is no requirement that all blocks be complete; the only requirement
is that they contain enough surface to be handled by assembly robotics and
joined to other blocks. Thus an approximation of a smooth curved surface with
no projecting points can be assembled from prismatic partial-cubes, and a
better approximation (marred only by joint lines and crystal steps) can be
achieved if the fabrication method allows curves to be built. Hydrodynamic
or molecular lubrication can be added after assembly; some lubricant molecules
might be built into the block faces during fabrication, though this would
probably have limited service life. Finally, in clean joints, nanoscale machinery
attached to one large surface can serve as a standoff or actuator for another
large surface, roughly equivalent to a forest of traction drives.
The grain scale may be large enough to affect some optical systems. In this
case, joints like those between blocks can be built at regular intervals within
the blocks, decreasing the lattice spacing and rendering it invisible to wave
propagation.
See the original
NIAC paper for discussion of factory architecture and extrusion speed.
Conclusion and Further Work
Surface assembly is a powerful approach to constructing meter-scale products
from sub-micron blocks, which can themselves be built by individual fabrication
systems implementing molecular manufacturing or directed self-assembly. Surface
assembly appears to be competitive with, and in many cases preferable to,
all previously explored systems for general-purpose manufacture of large products.
It is hard to find an example of a useful device that could not be built with
the technique, and the expected meter-per-hour extrusion rate means that even
large products could be built in their final configuration (as opposed to
folded).
What this means is that, once we have the ability to build billion-atom (submicron)
blocks of nanomachinery, it will be straightforward to combine them into large
products. The opportunities and problems of molecular manufacturing can develop
even faster than was previously thought.
C-R-Newsletter #24 November 4, 2004
CONTENTS
Wise-Nano Update
Engineers for a Sustainable World
CRN’s NIAC Project
Advanced Nanotechnology Conference
CRN Visits Brazil
Tri-fold Handout Available
San Francisco Nanotechnology Congress
Jolting the System
Feature Essay: Many Options for Molecular
Manufacturing
——————
Wise-Nano Update
Wise-Nano.org is CRN's newest project:
a collaborative website for researchers worldwide to work on the science,
implications, and policies of advanced nanotechnology. The site has expanded
rapidly, with about 100 pages/articles and more than 50 users. Not bad for
the first month of a new website! There are nine projects in varying stages
of completion, and six "Hot Debates" to get people thinking. Recent software
improvements include the ability to be emailed automatically when a "watched" page
changes. Stop by and use your editorial or authorial talents to write or improve
an article.
Engineers for a Sustainable World
Chris has been busy this past month, giving a talk at one conference, a poster
at a second, and two more talks at a third. First was the 2004 Engineers for
a Sustainable World (ESW) National
Conference, held September 30 to October 2 at Stanford University in
California. Chris's talk was on "New Technologies for Sustainability." The
conference was multi-tracked, and Chris's room was as big as any, but he
drew a standing-room-only crowd. The talk was well received. Chris was extremely
impressed by ESW. Their hearts are in the right place—and so are their
brains. The presentations made him realize the many difficulties inherent
in introducing new technology to people. Molecular
manufacturing has the potential to end most poverty, hunger, and even
many diseases. But this won't happen just by giving the technology away—it
has to be adopted and owned by the people it's supposed to help.
CRN’s NIAC Project
The second conference was the NASA Institute
for Advanced Concepts (NIAC) yearly
conference held October 19-20. We mentioned last month that Chris
has received a NIAC
grant to study how products can be built with molecular manufacturing.
One of the grant requirements is attendance at this conference and presentation
of a poster. Chris used the opportunity to network.
Advanced Nanotechnology Conference
The third event for Chris was the Foresight Institute's 1st
Conference on Advanced Nanotechnology: Research, Applications, and Policy,
October 21-24. For the past few years, the annual Foresight conference has
been focused on current lab research. This year, they confronted directly
the science and the implications of molecular manufacturing. The talks were
generally quite informative and forward-looking. Chris gave a talk on "Clean
Molecular Manufacturing" and another on "Molecular Manufacturing: Top Ten
Impacts." He also presented a poster on "Human rights implications of extremely
cheap molecular manufacturing." CRN was mentioned by several other speakers,
and was featured extensively in a review
article published online by Reason magazine.
CRN Visits Brazil
In mid-October, Mike flew to Sao Paulo, Brazil, to speak at the First
International Seminar on Nanotechnology, Society, and the Environment.
It was an intensive single-track seminar, organized by the University of
Sao Paulo, featuring two full days of presentations. About 60 people attended
the seminar, mostly academics, and some students. Mike was one of five international
participants. No one at the seminar seriously questioned the feasibility
of molecular manufacturing, although most were surprised by CRN's contention
that it likely will be developed in less than 20
years. Mike met many wonderful people there and looks forward to
working with them in assessing and preparing for the impact of nanotechnology
on the developing world. In connection with this, some of CRN's web
pages have now been translated and published
in Portuguese (in addition to Spanish and Chinese).
Tri-fold Handout Available
At the Foresight, NIAC, and Brazilian conferences, we gave away hundreds of
copies of a new tri-fold
handout. On one side, it describes CRN and the importance of our mission;
on the other side, it describes the Wise-Nano project
and invites participation. Copies of this handout are available free by
mail upon request.
San Francisco Nanotechnology Congress
In a few days, Mike will leave for California to speak at the International
Congress of Nanotechnology, being held November 7-11 in San Francisco.
Mike's talk will be on "Bridges to Safety, and Bridges to Progress." He
also will appear on a panel with other leading experts to discuss "the impact
of emerging technologies on society in the 21st century."
Jolting the System
Rensselaer Polytechnic Institute in Troy, New York, is hosting
a conference on "Nanotechnology: Innovation, Opportunity, and Commercialization." Mike
has been invited to make a presentation on November 16 titled "Jolt to the
System: The Transformative Impact of Nanotechnology."
Feature Essay: Many Options for Molecular Manufacturing
by Chris Phoenix, CRN Director of Research
Molecular manufacturing is the use of programmable chemistry to build exponential
manufacturing systems and high-performance products. There are several ways
this can be achieved, each with its own benefits and drawbacks. This essay
analyzes the definition of molecular manufacturing and describes several ways
to achieve the requirements.
Exponential Manufacturing Systems
An exponential manufacturing system is one that can, within broad limits,
build additional equivalent manufacturing systems. To achieve that, the products
of the system must be as intricate and precise as the original. Although there
are ways to make components more precise after initial manufacture, such as
milling, lapping, and other forms of machining, these are wasteful and add
complications. So the approach of molecular manufacturing is to build components
out of extremely precise building blocks—molecules and atoms, which
have completely deterministic structures. Although thermal noise will cause
temporary variations in shape, the average shape of two components with identical
chemical structures will also be identical, and products can be made with
no loss of precision relative to the factories.
The intricacy of a product is limited by its inputs. Self-assembled nanotechnology
is limited by this: the intricacy of the product has to be built into the
components ahead of time. There are some molecular components such as DNA
that can hold quite a lot of information. But if those are not used—and
even if they are—the manufacturing system will be much more flexible
if it includes a programmable manipulation function to move or guide parts
into the right place.
Programmable Chemistry: Mechanosynthesis
Chemistry is extremely flexible, and extremely common; every waft of smoke
contains hundreds or thousands of carbon compounds. But a lot of chemistry
happens randomly and produces intricate but uncontrolled mixtures of compounds.
Other chemistry, including crystal growth, is self-templating and can be very
precise, but produces only simple results. It takes special techniques to
make structures using chemistry that are both intricate and well-planned.
There are several different ways, at least in theory, that atoms can be joined
together in precise chemical structures. Individual reactive groups can be
fastened to a growing part. Small molecules can be strung together like beads
in a necklace. It's been proposed that small molecules can be placed like
bricks, building 3D shapes with the building blocks fastened together at the
edges or corners. Finally, weak parts can be built by self-assembly—subparts
can be designed to match up and fall into the correct position. It may be
possible to strengthen these parts chemically after they are assembled.
Mechanosynthesis is the term for building large parts by fastening a few atoms
at a time, using simple reactions repeated many times in programmable positions.
So far, this has been demonstrated for only a few chemical reactions, and
no large parts have been built yet. But it may not take many reactions to
complete a general-purpose
toolbox that can be used in the proper sequence and position to build
arbitrary shapes with fairly small feature sizes.
The advantage of a mechanosynthetic approach is that it allows direct fabrication
of engineered shapes, and very high bond densities (for strength). There are
two disadvantages. First, the range of molecular patterns that can be built
may be small, at least initially—the shapes may be quite programmable,
but lack the molecular subtlety of biochemistry. This may be alleviated as
more reactions are developed. Second, mechanosynthesis will require rather
intricate and precise machinery—of a level that will be hard to build
without mechanosynthesis. This creates a "bootstrapping" problem—how
to build the first fabrication machine. Scanning probe microscopes have the
required precision, or one of the lower-performance machine-building alternatives
described in this essay may be used to build the first mechanosynthesis machine.
Programmable Chemistry: Polymers and Possibilities
Biopolymers are long heterogeneous molecules borrowed from biology. They are
formed from a menu of small molecules called monomers stuck end-to-end in
a sequence that can be programmed. Different monomers have different parts
sticking out the sides, and some of these parts are attracted to the side
parts of other monomers. Because the monomer joining is flexible, these attractive
parts can pull the whole polymer molecule into a "folded" configuration that
is more or less stable. Thus the folded shape can be indirectly programmed
by choosing the sequence of monomers. Nucleic acid shapes (DNA and RNA) are
a lot easier to program than protein shapes.
Biopolymers have been studied extensively, and have a very flexible chemistry:
it's possible to build lots of different features into one molecule. However,
protein folding is complex (not just complicated, but inherently hard to predict),
so it's only recently become possible to design a sequence that will produce
a desired shape. Also, because there's only one chemical bond between the
monomers, biopolymers can't be much stronger than plastic. And because the
folded configurations hold their shapes by surface forces rather than strong
bonds, the structures are not very stiff at all, which makes engineering more
difficult. Biopolymers are constructed (at least to date) with bulk chemical
processes, meaning that it's possible to build lots of copies of one intricate
shape, but harder to build several different engineered versions. (Copying
by bacteria, and construction of multiple random variations, don't bypass
this limitation.) Also, reactants have to be flushed past the reaction site
for each monomer addition, which takes significant time and leads to a substantial
error rate.
A new kind of polymer has just
been developed. It's based on amino acids, but the bonds between them
are stiff rather than floppy. This means the folded shape can be directly
engineered rather than emerging from a complex process. It also means the
feature size should be smaller than in proteins, and the resulting shapes
should be stiffer. This appears to be a good candidate for designing near-term
molecular machine systems, since relatively long molecules can be built
with standard solution chemistry. At the moment, it takes about an hour
to attach each monomer to the chain, so a machine with many thousands of
features would not be buildable.
There's a theorized approach that's halfway between mechanosynthesis and polymer
synthesis. The idea is to use small homogeneous molecules that can be guided
into place and then fastened together. Because this requires lower precision,
and may use a variety of molecules and fastening techniques, this may be a
useful bootstrapping approach. Ralph Merkle wrote
a paper on it a few years ago.
A system that uses solution chemistry to build parts can probably benefit
from mechanical control of that chemistry. Whether by deprotecting only selected
sites to make them reactive, or mechanically protecting some sites while leaving
others exposed, or moving catalysts and reactants into position to promote
reactions at chosen sites, a fairly simple actuator system may be able to
turn bulk chemistry into programmable chemistry.
Living organisms provide one possible way to use biopolymers. If a well-designed
stretch of DNA is inserted into bacteria, then the bacteria will make the
corresponding protein; this can either be the final product, or can work with
other bacterial systems or transplanted proteins. (The bacteria also duplicate
the DNA, which may be the final product.) However, this is only semi-controlled
due to complex interactions within the bacterial system. Living organisms
dedicate a lot of structure and energy to dealing with issues that engineered
systems won't have to deal with, such as metabolism, maintaining an immune
system, food-seeking, reproduction, and adapting to environmental perturbations.
The use of bacteria as protein factories has already been accomplished, but
the use of bacteria-produced biopolymers for engineered-shape products has
only been done in a very small number of cases (e.g. Shih's recent octahedra
[PDF];
in this case it was DNA, not protein), and only for relatively simple shapes.
Manufacturing Systems, Again
Now that we have some idea of the range of chemical manipulations, we can
look at how those chemical shapes can be joined into machines. Machines are
important because some kind of machine will be necessary to translate programmed
information into mechanical operations. Also, the more functions that can
be implemented by nano-fabricated machines, the fewer will have to be implemented
by expensive, conventionally manufactured hardware.
A system with the ability to build intricate parts by mechanosynthesis or
small building blocks probably will be able to use the same equipment to move
those shapes around to assemble machines, since the latter function is probably
simpler and doesn't require much greater range of motion. A system based on
biopolymers could in theory rely on self-assembly to bring the molecules together.
However, this process may be slow and error-prone if the molecules are large
and many different ones have to come together to make the product. A bit of
mechanical assistance, grabbing molecules from solution and putting them in
their proper places while protecting other places from incorrect molecules
dropping in, would introduce another level of programmability.
Any of these operations will need actuators. For simple systems, binary actuators
working ratchets should be sufficient. Several kinds of electrochemical actuators
have been developed in recent months. Some of these may be adaptable for electrical
control. For initial bootstrapping, actuators controlled by flushing through
special chemicals (e.g. DNA strands) may work, although quite slowly. Magnetic
and electromagnetic fields can be used for quite precise steering, though
these have to be produced by larger external equipment and so are probably
only useful for initial bootstrapping. Mechanical control by varying pressure
has also been proposed for intermediate systems.
In order to scale up to handle large volumes of material and make large products,
computational elements and eventually whole computers will have to be built.
The nice thing about computers is that they can be built using anything that
makes a decent switch. Molecular electronics, buckytube transistors, and interlocking
mechanical systems are all candidates for computer logic.
High Performance Products
The point of molecular manufacturing is to make valuable products. Several
things can make a product valuable. If it's a computer circuit, then smaller
component size leads to faster and more efficient operation and high circuit
density. Any kind of molecular manufacturing should produce very small feature
sizes; thus, almost any flavor of molecular manufacturing can be expected
to make valuable computers. A molecular manufacturing system that can make
all the expensive components of its own machinery should also drive down manufacturing
cost, increasing profit margins for manufacturers and/or allowing customers
to budget for more powerful computers.
Strong materials and compact motors can be useful in applications where weight
is important, such as aerospace hardware. If a kilowatt or even just a hundred
watt motor can fit into a cubic millimeter, this will be worth quite a lot
of money for its weight savings in airplanes and space ships. Even if raw
materials cost $10,000 a kilogram, as some biopolymer ingredients do, a cubic
millimeter weighs about a milligram and would cost about a penny. Of course
this calculation is specious since the mounting hardware for such a motor
would surely weigh more than the motor itself. Also, it's not clear whether
biopolymer or building-block styles of molecular manufacturing can produce
motors with anywhere near this power density; and although the scaling laws
are pretty straightforward, nothing like this has been built or even simulated
in detail in carbon lattice.
Once a process is developed that can make strong programmable shapes out of
simple cheap chemicals, then product costs may drop precipitously. Mechanosynthesis
is expected to achieve this, as shown by the preliminary work on closed-cycle
mechanosynthesis starting with acetylene. No reaction cycle of comparable
cost has been proposed for solution chemistry, but it seems likely that one
can be found, given that some polymerizable molecules such as sugar are quite
cheap.
Future Directions
This essay has surveyed numerous options for molecular manufacturing. Molecular
manufacturing requires the ability to inject programmability for engineering,
but this can be done at any of several stages. For scalability, it also requires
the ability to build nanoscale machines capable of building their duplicates.
There are several options for machines of various compositions and in various
environments.
At the present time, no self-duplicating chemical-building molecular machine
has been designed in detail. However, given the range of options, it seems
likely that a single research group could tackle this problem and build at
least a partial proof of concept device—perhaps one that can do only
limited chemistry, or a limited range of shapes, but is demonstrably programmable.
Subsequent milestones would include:
1) Not relying on flushing sequences of chemicals past the machine
2) Machines capable of general-purpose manufacturing
3) Structures that allow several machines to cooperate in building large products
4) Building and incorporating control circuits
Once these are achieved, general-purpose molecular manufacturing will not
be far away. And that will allow the pursuit of more ambitious goals, such
as machines that can work in gas (instead of solution) or vacuum for greater
mechanical efficiency. Working in inert gas or vacuum also provides a possible
pathway (one of several) to what may be the ultimate performer: products built
by mechanosynthesis out of carbon lattice.
C-R-Newsletter #23 September 29, 2004
CONTENTS
SAGE Crossroads Webcast Features Mike Treder
CRN Creates Wise-Nano.org Collaborative
Website
Chris Phoenix Receives NIAC grant
CRN Given Consultant Status on Millennium
Project
Mike to Work Full-time for CRN
CRN Speaks
Chris to address engineers at Stanford
Mike to speak at conference in Brazil
Chris to make two presentations at Foresight’s Washington
DC conference
Mike invited to Italy in February for Expert Group Meeting
on "North-South Dialog on Nanotechnology"
Feature Essay: Coping with Nanoscale Errors
——————
It’s been an eventful month for us, with big news and exciting developments.
Thanks to your support and participation, things are really happening for
CRN!
SAGE Crossroads Webcast Features Mike Treder
CRN executive director Mike Treder was
invited to appear as a guest on an hour-long SAGE Crossroads webcast. Topics
included the effects of nanomedicine on battling disease and aging, the need
for further public discussion of both the risks and benefits of molecular
manufacturing, and the possibilities and desirability of human enhancement
technologies. The webcast was taped in a Washington DC television studio
on September 16, and posted for viewing on the Internet on September 27.
It’s available
online now.
CRN Creates Wise-Nano.org Collaborative Website
CRN's Director of Research, Chris Phoenix,
has been hard at work on an important new endeavor called the Wise-Nano project,
a collaborative website to study the facts and implications of advanced nanotechnology.
The site is hosted by CRN, but it’s intended to grow far beyond our
control, attracting researchers from all over the globe who are concerned
about the various aspects of nanotechnology.
Building a foundation for wise nanotechnology will not be easy. Chemists,
political scientists, physicists, lawyers, engineers, economists, sociologists,
medical doctors, environmentalists, and ethicists will need to work together
to ask and answer the right questions.
Please let us know what you think of the
site. When you went there, were you tempted to add an article or two?
Did you? Would you use it to get feedback or help on your projects? Why
or why not? What would make it more usable? What would inspire you to tell
your friends about it?
Chris Phoenix Receives NIAC grant
The NASA Institute for Advanced Concepts (NIAC) has announced that Chris Phoenix
has been selected to receive a Phase I grant on the subject of "Large-Product
General-Purpose Design and Manufacturing Using Nanoscale Modules". Chris
will be Principal Investigator (PI) for the study and will be assisted by
Tihamer Toth-Fejel of General Dynamics, who recently finished a NIAC study
on self-replicating machines.
CRN Given Consultant Status on Millennium Project
We’re pleased to report that the American Council to the United Nations University (AC/UNU) has designated CRN as a Consultant to their Millennium Project. We’ve written before about this fascinating project, an ongoing survey of attitudes and forecasts concerning advanced technology and changing societal conditions over the course of the next several decades. Because nanotechnology will make significant impacts on virtually everyone, it’s vital to include an exploration of benefits and risks—as well as administration options—in their future scenarios.
Anyone interested in contributing opinions to the current AC/UNU survey on "Environmental
Pollution and Health Hazards Resulting From Military Uses of Nanotechnology" is invited
to participate.
Mike Treder to Work Full-time for CRN
Ever since CRN was founded in December 2002, we have worked toward the time
when both Chris Phoenix and Mike Treder could devote full-time effort to the
organization. Now, we finally have reached that point.
We only have enough funding currently to cover us for about six or seven months.
However, we are exploring promising new avenues of support so that CRN can
maintain and expand our impact in research and formulation of much-needed
nanotechnology policy. If you can contribute a few dollars—or more than
a few dollars—that will really make
a difference.
CRN Speaks
As we’re posting this newsletter, Chris is on his way to California
to address the 2004 Engineers
for a Sustainable World National Conference, being held September 30
to October 2 at Stanford University in Palo Alto. He will speak on "Molecular
Manufacturing: Flexible Sustainable Solutions".
In a couple of weeks, Mike will leave for São Paulo, Brazil, to deliver
two talks at the First
International Seminar on Nanotechnology, Society, and the Environment.
This is an exciting opportunity to expose a new audience to CRN’s
ideas – especially since arrangements are being made to have Mike’s
talk presented live via streaming video on ten university websites all around
Latin America, Spain, and Portugal!
Chris will make two presentations at the 1st
Conference on Advanced Nanotechnology: Research, Applications, and Policy,
sponsored by the Foresight Institute. It's being held October 22-24, 2004,
in Washington DC.
Finally, Mike has been invited to take part in an Expert Group Meeting on "North-South
dialog on nanotechnology: challenges and opportunities" next February in Trieste,
Italy. The meeting is organized by the International
Centre for Science and High Technology, an Institute of the United Nations
operating in the framework of the United
Nations Industrial Development Organization (UNIDO). This is quite
an honor, and we are pleased to have the opportunity to contribute.
Feature Essay: Coping with Nanoscale Errors
by Chris Phoenix, CRN Director of Research
There is ample evidence that MIT’s Center
for Bits and Atoms is directed by a genius. Neil Gershenfeld has pulled
together twenty research groups from across campus. He has inspired them
to produce impressive results in fields as diverse as biomolecule motors
and cheap networked light switches. Neil teaches a wildly popular course
called "How to make (almost) anything", showing techies and non-techies
alike how to use rapid prototyping equipment to make projects that they
themselves are interested in. And even that is just the start. He has designed
and built "Fab Labs"—rooms with only $20,000 worth of rapid-prototyping
equipment, located in remote areas of remote countries, that are being used
to make crucial products. Occasionally he talks to rooms full of military
generals about how installing networked computers can defuse a war zone
by giving people better things to do than fight.
So when Neil
Gershenfeld says that there is no way to build large complex nanosystems
using traditional engineering, I listen very carefully. I have been thinking
that large-scale nano-based products can be designed and built entirely
with traditional engineering. But he probably knows my field better than
I do. Is it possible that we are both right? I've read his statements very
carefully several times, and I think that in fact we don't disagree. He
is talking about large complex nanosystems, while I am talking about large
simple nanosystems.
The key question is errors. Here's what Neil says about errors: "That, in
turn, leads to what I'd say is the most challenging thing of all that we're
doing. If you take the last things I've mentioned—printing logic, molecular
logic, and eventually growing, living logic—it means that we will be
able to engineer on Avogadro scales, with complexity on the scale of thermodynamics.
Avogadro's number, 1023, is the number of atoms in a macroscopic object, and
we'll eventually create systems with that many programmable components. The
only thing you can say with certainty about this possibility is that such
systems will fail if they're designed in any way we understand right now."
In other words, errors accumulate rapidly, and when working at the nanoscale,
they can and do creep in right from the beginning. A kilogram-scale system
composed of nanometer-scale parts will have on the order of 100,000,000,000,000,000,000,000
parts. And even if by some miracle it is manufactured perfectly, at least
one of those parts will be damaged by background radiation within seconds
of manufacture.
Of course, errors plague the large crude systems we build today. When an airplane
requires a computer to stay in the air, we don't use one computer—we
use three, and if one disagrees with the other two, we take it offline and
replace it immediately. But can we play the same trick when engineering with
Avogadro numbers of parts? Here's Neil again: "Engineers still use the math
of a few things. That might do for a little piece of the system, like asking
how much power it needs, but if you ask about how to make a huge chip compute
or a huge network communicate, there isn't yet an Avogadro design theory."
Neil is completely right: there is not yet an Avogadro design theory. Neil
is working to invent one, but that will be a very difficult and probably lengthy
task. If anyone builds a nanofactory in the next
five or ten years, it will have to be done with "the math of a few things." But
how can this math be applied to Avogadro numbers of parts?
Consider this: Every second, 100,000,000 transistors in your computer do 2,000,000,000
operations; there are 7,200 seconds in a two-hour movie; so to play a DVD,
about 1021 signal-processing operations have to take place flawlessly. That's
pretty close to Avogadro territory. And playing DVDs is not simple. Those
transistors are not doing the same thing over and over; they are firing in
very complicated patterns, orchestrated by the software. And the software,
of course, was written by a human.
How is this possible, and why doesn't it contradict Neil? The answer is that
computer engineering has had decades of practice in using the "math of a few
things." The people who design computer chips don't plan where every one of
those hundred million transistors goes. They design at a much higher level,
using abstractions to handle transistors in huge organized collections of
collections. Remember that Neil talked about "complexity on the scale of thermodynamics." But
there is nothing complex about the collections of transistors. Instead, they
are merely complicated.
The difference between complication and complexity is important. Roughly speaking,
a system is complex if the whole is greater than the sum of its parts: if
you can't predict the behavior that will emerge just from knowing the individual
behavior of separated components. If a system is not complex, then the whole
is equal to the sum of the parts. A straightforward list of features will
capture the system's behavior. In a complicated system, the list gets longer,
but no less accurate. Non-complex systems, no matter how complicated, can
in principle be handled with the math of a few things. The complications just
have to be organized into patterns that are simple to specify. The entire
behavior of a chip with a hundred million transistors can be described in
a single book. This is true even though the detailed design of the chip—the
road map of the wires—would take thousands of books to describe.
Neil
talked about one other very important concept. In signaling, and in
computation, it is possible to erase errors by spending energy. A computer
could be designed to run for a thousand years, or a million, without a single
error. There is a threshold of error rates below which the errors can be
reliably corrected. Now we have the clues we need to see how to use the
math of a few things to build complicated non-complex systems out of Avogadro
numbers of parts.
When I was writing my paper on "Design
of a Primitive Nanofactory", I did calculations of failure rates. In
order for quadrillions of sub-micron mechanisms to all work properly, they
would have to have failure rates of about 10-19. This is pretty close to
(the inverse of) Avogadro's number, and is essentially impossible to achieve.
The failure rate from background radiation is as high as 10-4. However,
a little redundancy goes a long way. If you build one spare mechanism for
every eight, the system will last somewhat longer. This still isn't good
enough; it turns out you need seven spares for every eight. And things are
still small enough that you have to worry about radiation in the levels
above, where you don't have redundancy. But adding spare parts is in the
realm of the math of a few things. And it can be extended into a workable
system.
The system is built out of levels of levels of levels: each level is composed
of several similar but smaller levels. This quasi-fractal hierarchical design
is not very difficult, especially since each level takes only half the space
of the next higher level. With many similar levels, is it possible to add
a little bit of redundancy at each level? Yes, it is, and it works very well.
If you add one spare part for every eight at each level, you can keep the
failure rate as low as you like—with one condition: the initial failure
rate at the smallest stage has to be below 3.2%. Above that number, and one-in-eight
redundancy won't help sufficiently—the errors will continue to grow.
But if the failure rate starts below 3.2%, it will decrease at each higher
redundant stage.
This analysis can be applied to any system where inputs can be redundantly
combined. For example, suppose you are combining the output of trillions of
small motors to one big shaft. You might build a tree of shafts and gears.
And you might make each shaft breakable, so that if one motor or collection
of motors jams, the other motors will break its shaft and keep working. This
system can be extremely reliable.
There is a limitation here: complex products can't be built this way. In effect,
this just allows more efficient products to be built in today's design space.
But that is good enough for a start: good enough to rebuild our infrastructure,
powerful enough to build horrific weapons in great quantity, high-performance
enough—even with the redundancy—to give us access to space; and
generally capable of producing the mechanical systems that molecular
manufacturing promises.
C-R-Newsletter #22 August 31, 2004
CONTENTS
The Hollowness of Denial
NNI FAQ Revised
NSF Meeting Misses the Point
Scott Mize New Foresight President
CRN Speaks
Mike to Debate Mihail Roco, Head of NNI
Mike was at TransVision, and on the Radio
Chris to speak in Brazil, Foresight, at Stanford, etc.
First Quarterly Report Delivered
Feature Essay: Living Off-Grid With Molecular
Manufacturing
——————
Patrick Bailey has published an
article at Betterhumans.com that shows how bankrupt skepticism about
molecular manufacturing is. Titled "Unraveling the Big Debate over Small
Machines", the article examines and destroys the arguments against molecular
manufacturing. For example, Richard Smalley claimed that enzymes only work
underwater. But twenty years of experiment and hundreds of published papers
prove that he's ignorant on that point.
Combined with Lawrence Lessig's short but pointed article
in Wired last month, it looks like the politicized scientists and professional
skeptics are finally starting to discover they can't fool all of the people
all of the time. See also the next news item.
For months, the FAQ (Frequently Asked Questions) page of the U.S. National Nanotechnology Initiative has said that nanobots are impossible "creatures" because "nanoscale materials are simply too small to manipulate for such purposes," and dangerous besides. They have finally removed that misleading entry, after complaints from a variety of journalists and researchers including CRN's Chris Phoenix. At this time, the page does not mention molecular manufacturing at all, but that's an improvement over the way it was. We hope the NNI will address molecular manufacturing sometime before it's developed.
The National Science Foundation held an international meeting in June 2004
to consider the responsible development of nanotechnology. This is a laudable
goal. However, their just-published final
report focuses on nanoparticles and reflects no awareness or consideration
of molecular manufacturing—the most significant long-term consequence
of nanotechnology. This reduces both the relevance
and the credibility of their efforts. Their argument seems to be that molecular
manufacturing is "not scientifically verified". But requiring absolute proof
before addressing an issue is not a responsible approach.
In addition, their framing of the discussion can lead to confusion. The report
asks whether nanotechnology will be "inherently continuous or inherently disruptive," but
this leads to a digression about "novel properties that only become evident
at the nanoscale".
Calling a meeting to consider a problem, and then considering the easy half
of the problem while ignoring the other half, is not the act of an organization
that actually wants to deal responsibly with a new technology. We are considering
what level of action is appropriate to spread the word about the glaring deficiencies
in this project.
Scott Mize New Foresight President
After many years as president of the Foresight Institute, Christine Peterson has turned the post over to Scott Mize. Scott, previously a co-founder of AngstroVision (a company that developed a significant nanoscale vision technology), has given CRN a sneak preview of his plans, and they're pretty exciting. Considering that they've also reinvented the Foresight Conference, which this year will focus on molecular manufacturing and its policy rather than nanoscale technology, we expect to be hearing more from Foresight in the near future. This is excellent news; as we've said all along, preparing for molecular manufacturing will require far too much work for any one organization to do.
On September 27, CRN Executive Director Mike
Treder will debate—or, hopefully, discuss—advanced nanotechnology,
anti-aging research, and the risks of nanotechnology with Mihail Roco, head
of the U.S. National Nanotechnology Initiative. This is a real feather in
the cap for CRN. It will be interesting to see what Roco has to say about
molecular manufacturing.
In early August, Mike gave a presentation on "Making a Safe Transition into
the Nano Era" at TransVision
2004 in Toronto, to an audience of about 50 scientists, academics, journalists,
and interested observers.
Mike also was
interviewed on the Future Tense radio program. He spoke about the possible
environmental impacts of advanced nanotechnology, as well as ubiquitous
surveillance, economic disruption, and the technology's humanitarian potential.
Director of Research Chris Phoenix will have a busy few months—two new
trips have been added to his schedule since last month. In mid-September he's
been invited to Washington D.C. to participate in a "Workshop On the Social,
Ecological, and Ethical Implications of Nanotechnology Research and Development" held
by the Loka Institute. He'll be on a panel
of experts to inform a discussion group about nanotechnology issues.
And in mid-October, Chris is going to Brazil! The First
International Seminar on Nanotechnology, Society, and the Environment has
invited him to speak. Chris is looking forward to meeting a whole new group
of people studying nanotechnology and its implications.
As we said last month, Chris has been invited to make a presentation at the
2004 Engineers
for a Sustainable World National Conference, being held September 30
to October 2 at Stanford University in Palo Alto, California. He will speak
on "Molecular Manufacturing: Flexible Sustainable Solutions". Chris also
will make two presentations at the 1st
Conference on Advanced Nanotechnology: Research, Applications, and Policy,
sponsored by the Foresight Institute. It's being held October 22-24, 2004,
in Washington DC. Finally, Chris has been invited to Las Vegas by the Las
Vegas Futurists group to give a talk on (what else?) responsible
nanotechnology.
First Quarterly Report Delivered
The inaugural issue of CRN’s Responsible Nanotechnology Report, issued
for the 3rd Quarter of 2004, is being delivered to C-R-Network members. The
10-page report covers nanotechnology science and policy developments as well
as CRN activities. This quarterly report is free, but it is available only
to those who have joined the C-R-Network, which also is free of charge.
For information on signing up for the Network and receiving the quarterly
Responsible Nanotechnology Report, click here.
Feature Essay: Living Off-Grid With Molecular Manufacturing
by Chris Phoenix, CRN Director of Research
Living off-grid can be a challenge. When energy and supplies no longer arrive
through installed infrastructure, they must be collected and stored locally,
or done without. Today this is done with lead-acid batteries, expensive water-handling
systems, and so on. All these systems have limited capacities. Conversely,
living on-grid creates a distance between production and consumption that
makes it easy to ignore the implications of excessive resource usage. Molecular
manufacturing can make off-grid living more practical, with clean local
production and easy managing of local resources.
For this essay, I will assume a molecular manufacturing technology based on
mechanosynthesis of carbon lattice. A bio-inspired nanotechnology would share
many of the same advantages. Carbon lattice (including diamond) is about 100
times as strong as steel per volume, and carbon is one-sixth as dense. This
implies that a structure made of carbon would weigh at most 1% of the weight
of a steel structure. This is important for several reasons, including cost
and portability. However, in most things made of steel, much of the material
is resisting compression, which requires far more bulk than resisting the
same amount of tension. (It's easier to crumple a steel bar than to pull it
apart.) When construction in fine detail doesn't cost any extra, it's possible
to convert compressive stress to tensile stress by using trusses or pressurized
tanks. So it'll often be safe to divide current product weight by 1,000. The
cost of molecular-manufactured carbon lattice might be $20 per kg ($10 per
pound) at today's electricity prices, and drop rapidly as nanofactories are
improved and nano-manufactured solar cells are deployed. This makes it very
competitive with steel as a structural material.
A two or three order of magnitude improvement in material properties, and
a six order of magnitude improvement in cost per feature and compactness of
motors and computers, allows the design of completely new kinds of products.
For example, a large tent or a small inflatable boat may weigh 10 kilograms.
But building with advanced materials, this is equal to 1,000 or even 10,000
kilograms: a house or a yacht. Likewise, a small airplane or seaplane might
weigh 1,000 kg today. A 10 kg full-sized collapsible airplane is not implausible;
today's hang gliders weigh only 30-40 kg, and they're built out of aluminum
and nylon. Such an airplane would be easy to store and cheap to build, and
could of course be powered by solar-generated fuel.
Today, equipment and structures must be maintained and their surfaces protected.
This generates a lot of waste and uses a lot of paint and labor. But, as the
saying goes, diamonds are forever. This is because in a diamond all the atoms
are strongly bonded to each other, and oxygen (even with the help of salt)
can't pull one loose to start a chemical reaction. Ultraviolet light can be
blocked by a thin surface coating molecularly bonded to the structure during
construction. So diamondoid structures would require no maintenance to prevent
corrosion. Also, due to the strongly bonded surfaces, it appears that nanoscale
machines will be immune to ordinary wear. A machine could be designed to run
without maintenance for a century.
Can molecular manufacturing build all the needed equipment? It appears so;
carbon is an extremely versatile atom. It can be a conductor, semiconductor,
or insulator; opaque or transparent; it can make inorganic (and indigestible)
substances like diamond and graphite, but with a few other readily available
atoms, it can make incredibly complex and diverse organic chemicals. And don't
forget that a complete self-contained molecular manufacturing system can be
quite small. So any needed equipment or products could be made on the spot,
out of chemicals readily available from the local environment. A self-contained
factory sufficient to supply a family could be the size of a microwave oven.
When a product is no longer wanted, it can be burned cleanly, being made entirely
of light atoms. It is worth noting that extraction of rare minerals from ecologically
or politically sensitive areas would become largely unnecessary.
Power collection and storage would require a lot fewer resources. A solar
cell only has to be a few microns thick. Lightweight expandable or inflatable
structures would make installation easy and potentially temporary. Energy
could be stored as hydrogen. The solar cells and the storage equipment could
be built by the on-site nanofactory. The same
goes for solar water distillers, and tanks and greenhouses for growing fish,
seaweed, algae, or hydroponic gardening. Water can also be purified electrically
and recovered from greenhouse air, and direct chemical food production using
cheap microfluidics will probably be an early post-nanofactory development.
With food, fuel, and equipment all available locally, there would be very
little need to ship supplies from centralized production facilities, and water
use per person could be much less than with open-air agriculture and today's
problems with handling wastewater.
The developed nations today have a massive and probably unsustainable ecological
footprint. Because production is so decentralized, it is hard to observe the
impact of consumer choices. And because only a few areas of land are convenient
for transportation or ideal for agriculture, unhealthy patterns of land use
have developed. Economies of scale encourage large infrastructures. But nano-built
equipment benefits from other economies, so off-site production and distribution
will become less efficient than local productivity. Someone living off-grid
will be able literally to see their own ecological footprint, simply by looking
at the land area they have covered with solar cells and greenhouses. Cheap
sensors will allow monitoring of any unintentional pollution—though
there will be fewer pollution sources with clean manufacturing of maintenance-free
products.
Cheap high-bandwidth communication without wires would require a new infrastructure,
but it would not be hard to build one. Simply sending up small airplanes with
wireless networking equipment would allow wireless communication for hundreds
of miles.
Incentive for theft might decrease, since people could more quickly and easily
build what they want for themselves rather than stealing other people's homemade
goods.
Molecular manufacturing should make it very easy to disconnect from today's
industrial grid. Even with relatively primitive (early) molecular manufacturing,
people could have far better quality of life off-grid than in today's slums,
while doing significantly less ecological damage. Areas that are difficult
to live in today could become viable living space. Although this would increase
the spread of humans over the globe, it would reduce the use of intensive
agriculture, centralized energy production, and transportation; the ecological
tradeoffs appear favorable. (With careful monitoring of waste streams, this
argument may even apply to ocean living.)
Everything written here also could apply to displaced persons. Instead of
refugee camps where barely adequate supplies are delivered from outside and
crowding leads to increased health problems, relatively small amounts of land
would allow each family (or larger social group) to be self-sufficient. This
would not mitigate the tragedy of losing their homes, but would avoid compounding
the tragedy by imposing the substandard or even life-threatening living conditions
of today's refugee camps.
Of course, this essay has only considered the technical aspects of off-grid
living. The practical feasibility depends on a variety of social and political
issues. Many people enjoy living close to neighbors. Various commercial interests
may not welcome the prospect of people withdrawing from the current consumer
lifestyle. Owners of nanofactory technology may charge licensing fees too
high to permit disconnection from the money system. Some environmental groups
may be unwilling to see large-scale settlement of new land areas or the ocean,
even if the overall ecological tradeoff were positive. But the possibility
of self-sufficient off-grid living would take some destructive pressure off
of a variety of overpopulated and over-consuming societies. Although it is
not a perfect alternative, it appears to be preferable in many instances to
today's ways of living and using resources.
C-R-Newsletter #21 July 31, 2004
CONTENTS
Indian President Calls for Military Nanotechnology
Lawrence Lessig's Wired Article in Support
of Molecular Manufacturing
Britain's Royal Society Ignores Molecular
Manufacturing
From Russia: "Roadmap to Automated Diamond
Mechanosynthesis"
NCSU Survey on Public Opinion of Nanotechnology
CRN's Blogging Success
Upcoming Speaking Engagements
Feature Essay: Scaling Laws—Back
to Basics
——————
Indian President Calls for Military Nanotechnology
The president of India, A. P. J. Abdul Kalam, has called for India to develop nanotechnology — including nanobots — because it will revolutionize warfare. Kalam is, literally, a rocket scientist, and he made this call in a speech at a military function; it seems likely that he's serious. Now, arms races don't always lead to war, but it may be difficult to have a stable arms race when no one has a clue what weapons may be developed and which ones will be destabilizing. (Remember that anti-ballistic missiles, a defensive technology, had the potential to destabilize the nuclear arms race.) This underscores the need for more studies: Which advanced manufacturing technologies can be developed, and when, and what can be built using them, and what are the implications of those products? These questions are the focus of our Thirty Essential Studies. Links to the India story are available in a post on our blog.
BREAKING NEWS: On July 31, 2004, President Kalam published in Hindustan Times an adaptation of his April address to scientists in Delhi. In it, Kalam writes, "When I think of nanoscience and nanotechnology, I am reminded of three personalities." The second name he lists is Eric Drexler, and the reason given is Drexler's technical work, Nanosystems: Molecular Machining, Manufacturing, and Computation. We've heard suggestions that Kalam was following the official U.S. and British line that nanotechnology is only about nanoscale technology and doesn't include molecular manufacturing. But this should remove all doubt that Kalam knows what molecular manufacturing is and that he thinks it deserves attention.
Lawrence Lessig's Wired Article in Support of Molecular
Manufacturing
Lawrence Lessig, a law professor at Stanford University, has written a hard-hitting article about "the politics of science" surrounding molecular manufacturing. Lessig writes, "The world of federal funding would only be safe, critics believed, if the idea of bottom-up nanotech could be erased." Lessig cites the removal of molecular manufacturing from the Nano Act, and Richard Smalley's objections which, as noted by Lessig and the editors of Chemical and Engineering News, "go beyond the scientific." Lessig's article is online.
Britain's Royal Society Ignores Molecular Manufacturing
Denial of molecular manufacturing is not limited to the United States. Britain's Royal Society has been working for a bit over a year to address concerns about nanotechnology, with initial impetus provided by Prince Charles's worries about 'grey goo'. Although grey goo is not a high-priority concern, the idea originated in studies of molecular manufacturing, and was introduced to the public — along with the word 'nanotechnology' — in Eric Drexler's book Engines of Creation.
They've just published their
findings. But the phrases 'molecular manufacturing' and 'molecular nanotechnology'
do not appear anywhere in the body of the report. Even the word 'Drexler'
appears only once, in a claim that he has "retracted his position". Anyone
who's actually read the paper they're
referring to knows it's not that simple. The report does not reference
any of Drexler's technical writing. And it claims that they've seen no
peer-reviewed evidence that molecular manufacturing can work. It appears
they didn't
look very hard.
In explaining why grey goo is impossible, the report cites a variation of
Richard Smalley's 'fingers' argument. Instead of saying, as Smalley did, that
the fingers would have to pick up atoms, this version admits that the atoms
would chemically bond to the fingers and then transfer their bonds to the
workpiece. But this drastically weakens the argument, since atoms transferring
bonds from one molecule to another is what chemistry is all about. We find
it very interesting that Smalley's original argument was apparently recognized
as being too silly to use. But we are disappointed that they did not take
the additional small step of admitting that the argument is unfounded.
On the positive side, the report gives a lot of detail about nanoscale technology
applications, discusses their risks, and makes frequently-reasonable recommendations
for further action. But the lack of analysis of molecular manufacturing is
unfortunate. And given that several nations and organizations have recently
expressed an interest in developing it, the flat denial of its possibility
can only be called irresponsible.
From Russia: "Roadmap to Automated Diamond Mechanosynthesis"
A group in Russia has published a "roadmap to automated diamond mechanosynthesis” (read story on our blog). We have not yet seen a copy, but the table of contents makes it quite clear: the authors expect diamond to be buildable by small robotic devices.
NCSU Survey on Public Opinion of Nanotechnology
North Carolina State University recently published the results of a survey on public opinion of nanotechnology. Although the survey did not distinguish between nanoscale technologies and molecular manufacturing, the results are interesting. Eighty percent of the people surveyed said they had heard "little" or "nothing" about nanotechnology. Out of a list of five most worrisome dangers, "a nanotechnology inspired arms race" was chosen second, by 24% of the people, and "the uncontrollable spread of self-replicating nano-robots" was last at 12%. Forty percent said benefits would outweigh risks, while only 22% said the opposite. Eighty percent said they are not worried at all about nanotechnology. It looks like the NanoBusiness fears that the grey goo issue will hurt the field may be exaggerated.
It's been six months since we started our Responsible Nanotechnology blog. We've made 270 posts, which have attracted almost 1500 comments. We've been very pleased at the high quality of discussion—we've received more than a few good ideas from the participants, and have been challenged to double-check our work in some areas. Thank you!
Executive Director Mike Treder will deliver a talk on "Making a Safe Transition
into the Nano Era" at TransVision
2004: Art and Life in the Posthuman Era, taking place August 6-8, 2004,
at the University of Toronto in Ontario, Canada.
Research Director Chris Phoenix will be busy over the next few months. He
has been invited to make a presentation at the 2004
Engineers for a Sustainable World National Conference, being held September
30 to October 2 at Stanford University in Palo Alto, California. He will
speak on "Molecular Manufacturing: Flexible Sustainable Solutions".
Chris also will make two presentations at the 1st
Conference on Advanced Nanotechnology: Research, Applications, and Policy,
sponsored by the Foresight Institute. It's being held October 22-24, 2004,
in Washington DC.
Finally, Chris has been invited to Nevada by the Las
Vegas Futurist group to give a talk on (what else?) responsible nanotechnology.
Feature Essay: Scaling Laws—Back to Basics
by Chris Phoenix, CRN Director of Research
Scaling laws are extremely simple observations about how physics works at
different sizes. A well-known example is that a flea can jump dozens of times
its height, while an elephant can't jump at all. Scaling laws tell us that
this is a general rule: smaller things are less affected by gravity. This
essay explains how scaling laws work, shows how to use them, and discusses
the benefits of tinyness with regard to speed of operation, power density,
functional density, and efficiency—four very important factors in the
performance of any system.
Scaling laws provide a very simple, even simplistic approach to understanding
the nanoscale. Detailed engineering requires more intricate calculations.
But basic scaling law calculations, used with appropriate care, can show why
technology based on nanoscale devices is expected to be extremely powerful
by comparison with either biology or modern engineering.
Let's start with a scaling-law analysis of muscles vs. gravity in elephants
and fleas. As a muscle shrinks, its strength decreases with its cross-sectional
area, which is proportional to length times length. We write that in shorthand
as strength ~ L2. (If you aren't comfortable with 'proportional to', just
think 'equals': strength = L squared.) But the weight of the muscle is proportional
to its volume: weight ~ L3. This means that strength vs. weight, a crude indicator
of how high an organism can jump, is proportional to area divided by volume,
which is L2 divided by L3 or L-1 (1/L). Strength-per-weight gets ten times
better when an organism gets ten times smaller. A nanomachine, nearly a million
times smaller than a flea, doesn't have to worry about gravity at all. If
the number after the L is positive, then the quantity becomes larger or more
important as size increases. If the number is negative, as it is for strength-per-weight,
then the quantity becomes larger or more important as the system gets smaller.
Notice what just happened. Strength and mass are completely different kinds
of thing, and can't be directly compared. But they both affect the performance
of systems, and they both scale in predictable ways. Scaling laws can compare
the relative performance of systems at different scales, and the technique
works for any systems with the relevant properties—the strength of a
steel cable scales the same as a muscle. Any property that can be summarized
by a scaling factor, like weight ~ L3, can be used in this kind of calculation.
And most importantly, properties can be combined: just as strength and weight
are components of a useful strength-per-weight measure, other quantities like
power and volume can be combined to form useful measures like power density.
An insect can move its legs back and forth far faster than an elephant. The
speed of a leg while it's moving may be about the same in each animal, but
the distance it has to travel is a lot less in the flea. So frequency of operation
~ L-1. A machine in a factory might join or cut ten things per second. The
fastest biochemical enzymes can perform about a million chemical operations
per second.
Power density is a very important aspect of machine performance. A basic law
of physics says that power is the same as force times speed. And in these
terms, force is basically the same as strength. Remember that strength ~ L2.
And we're assuming speed is constant. So power ~ L2: something 10 times as
big will have 100 times as much power. But volume ~ L3, so power per volume
or power density ~ L-1. Suppose an engine 10 cm on a side produces 1,000 watts
of power. Then an engine 1 cm on a side should produce 10 watts of power:
1/100 of the ten-times-larger engine. Then 1,000 1-cm engines would take the
same volume as one 10-cm engine, but produce 10,000 watts. So according to
scaling laws, by building 1,000 times as many parts, and making each part
10 times smaller, you can get 10 times as much power out of the same mass
and volume of material. This makes sense—remember that frequency of
operation increases as size decreases, so the miniature engines would run
at ten times the RPM.
Notice that when the design was shrunk by a factor of 10, the number of parts
increased by a factor of 1,000. This is another scaling law: functional density
~ L-3. If you can build your parts nanoscale, a million times smaller, then
you can pack in a million, million, million, or 1018 more parts into the same
volume. Even shrinking by a factor of 100, as in the difference between today's
computer transistors and molecular electronics, would allow you to cram a
million times more circuitry into the same volume. Of course, if each additional
part costs extra money, or if you have to repair the machines, then using
1,000 times as many parts for 10 times the performance is not worth doing.
But if the parts can be built using a massively parallel process like chemistry,
and if reliability is high and the design is fault-tolerant so that the collection
of parts will last for the life of the product, then it may be very much worth
doing—especially if the design can be shrunk by a thousand or a million
times.
An internal combustion engine cannot be shrunk very far. But there's another
kind of motor that can be shrunk all the way to nanometer scale. Electrostatic
forces—static cling—can make a motor turn. As the motor shrinks,
the power density increases; calculations show that a nanoscale electrostatic
motor may have a power density as high as a million watts per cubic millimeter.
And at such small scales, it would not need high voltage to create a useful
force.
Such high power density will not always be necessary. When the system has
more power than it needs, reducing the speed of operation (and thus the power)
can reduce the energy lost to friction, since frictional losses increase with
increased speed. The relationship varies, but is usually at least linear—in
other words, reducing the speed by a factor of ten reduces the frictional
energy loss by at least that much. A large-scale system that is 90% efficient
may become well over 99.9% efficient when it is shrunk to nanoscale and its
speed is reduced to keep the power density and functional density constant.
Friction and wear are important factors in mechanical design. Friction is
proportional to force: friction ~ L2. This implies that frictional power is
proportional to the total power used, regardless of scale. The picture is
less good for wear. Assuming unchanging pressure and speed, the rate of erosion
is independent of scale. However, the thickness available to erode decreases
as the system shrinks: wear life ~ L, so a nanoscale system plagued by conventional
wear mechanisms might have a lifetime of only a few seconds. Fortunately,
a non-scaling mechanism comes to the rescue here. Chemical covalent bonds
are far stronger than typical forces between sliding surfaces. As long as
the surfaces are built smooth, run at moderate speed, and can be kept perfectly
clean, there should be no wear, since there will never be a sufficient concentration
of heat or force to break any bonds. Calculations and preliminary experiments
have shown that some types of atomically precise surfaces can have near-zero
friction.
Of course, all this talk of shrinking systems should not obscure the fact
that many systems cannot be shrunk all the way to the nanoscale. A new system
design will have its own set of parameters, and may perform better or worse
than scaling laws would predict. But as a first approximation, scaling laws
show what we can expect once we develop the ability to build nanoscale systems:
performance vastly higher than we can achieve with today's large-scale machines.
For more information on scaling laws and nanoscale systems, including discussion
of which laws are accurate at the nanoscale, see Nanosystems,
chapter 2.
C-R-Newsletter #20 June 30, 2004
CONTENTS
Phoenix/Drexler "Safe Exponential Manufacturing" Article
Review and Discussion of "Thirty Essential
Nanotechnology Studies" on CRN blog
CRN Announces Student Research Program
NASA Study on Machine Self-Replication: It's
Surprisingly Easy
Images of a Tabletop Nanofactory
Feature Essay: Engineering, Biology, and
Nanotechnology
------------
Phoenix/Drexler "Safe Exponential Manufacturing" Article
The 'grey goo scenario', in which runaway self-replicating machines devour
the biosphere, has haunted and distorted discussion of molecular
manufacturing for many years. Although some kinds of free-range self-replicating
devices appear to be physically possible, we don't think runaway replication
is the biggest danger posed by molecular manufacturing, since development
of such devices would require massive and pointless engineering effort.
Eric Drexler joined with CRN Research Director Chris Phoenix to write a paper, "Safe
Exponential Manufacturing", which appeared in the August 2004 issue of the
Institute of Physics journal Nanotechnology. Yes, we know it's not August
yet, but the paper has been published
online (registration required). The paper is also available as a PDF
file on our website. Press releases were issued by CRN,
and Foresight,
and the
IoP, and Eric was interviewed,
and the BBC did a good article.
Press reaction was interesting. Overall, the reaction was positive. England covered the story pretty thoroughly and fairly. Australia picked it up. But the U.S. mostly ignored it. Perhaps this is because Prince Charles had been worried about grey goo; perhaps because IoP is a British journal; but we suspect it's because the U.S. still has a habit of pretending that molecular manufacturing doesn't exist and talking about it as little as possible.
Review and Discussion on CRN blog of "Thirty Essential
Nanotechnology Studies"
Last month we announced the publication of a large list of urgently-needed nanotechnology studies. We've been posting these studies on our blog, one at a time, for comment and criticism. So far, reaction has been quite positive. We've gotten some helpful suggestions, but no major criticism, and several great discussions have been started.
CRN Announces Student Research Program
With so much to be studied, there's no way CRN can do more than point the way and scratch the surface. So we've created and announced a student research program. It's targeted at undergrads, but advanced high school students and grad students can also apply. The instructor supervises the work, which should make it easier for students to get course credit. We provide review and advice. Both the instructor and the student have direct access to CRN's Director of Research.
NASA Study on Machine Self-Replication: It's Surprisingly
Easy
The NASA Institute for Advanced Concepts funds
studies of advanced technologies. A study
of machine self-replication (PDF) recently was completed. The study
investigated how simple parts could be mechanically assembled to build a
complex machine that could mechanically assemble simple parts. It did not
investigate how to build the simple parts, and in fact, it did not specify
the size of the parts—the same design should work for both large and
nanoscale parts, making research easier. It did point out that either dry
chemistry (Drexler-style) or wet chemistry (Smalley's favorite) could be
used to build the parts.
With very few parts, a complete machine could be assembled, including a computer
and motors. Perhaps the most interesting conclusion of the study was that
a self-replicating machine could be less complex than a Pentium 4 chip! It's
often assumed that any self-replicating machine would be impossible to design;
they have demonstrated that it's actually easier than some things that have
already been done.
We hosted a discussion of the study on
our blog.
Images of a Tabletop Nanofactory
John Burch has made some great pictures of a desktop nanofactory, illustrating how mundane and user-friendly advanced nanotechnology could be. Images in several resolutions are available on Foresight's website. Last year, Chris published a long and detailed paper calculating the size, mass, speed, reliability, and many other aspects of a nanofactory.
Feature Essay: Engineering, Biology, and Nanotechnology
by Chris Phoenix, CRN Director of Research
The question of whether a computer can think is no more interesting than
the question of whether a submarine can swim.
—Edsger W. Dijkstra
A dog can herd sheep, smell land mines, pull a sled, guide a blind person,
and even warn of oncoming epileptic seizures.
A computer can calculate a spreadsheet, typeset a document, play a video,
display web pages, and even predict the weather.
The question of which one is 'better' is silly. They're both incredibly useful,
and both can be adapted to amazingly diverse tasks. The dog is more adaptable
for tasks in the physical world—and does not require engineering to
learn a new task, only a bit of training. But the closest a dog will ever
come to displaying web pages is fetching the newspaper.
Engineering takes a direct approach to solving tasks that can be described
with precision. If the engineering is sound, the designs will work as expected.
Engineered designs can then form the building blocks of bigger systems. Precisely
mixed alloys make uniform girders that can be built into reliable bridges.
Computer chips are so predictable that a million different computers running
the same computer program can reliably get the same result. For simple problems,
engineering is the way to go.
Biology has never taken a direct approach, because it has never had a goal.
Organisms are not designed for their environment; they are simply the best
tiny fraction of uncountable attempts to survive and replicate. Over billions
of years and a vast spectrum of environments and organisms, the process of
trial and error has accumulated an awesome array of solutions to an astonishing
diversity of problems.
Until recently, biology has been the only agent that was capable of making
complicated structures at the nanoscale. Not only complicated structures,
but self-reproducing structures: tiny cells that can use simple chemicals
to make more cells, and large organisms made of trillions of cells that can
move, manipulate their environment, and even think. (The human brain has been
called the most complex object in the known universe.) It is tempting to think
that biology is magic. Indeed, until the mid-1800's, it was thought that organic
chemicals could not be synthesized from inorganic ones except within the body
of a living organism.
The belief that there is something magical or mystical about life is called
vitalism, and its echoes are still with us today. We now know that any organic
chemical can be made from inorganic molecules or atoms. But just last year,
I heard a speaker—at a futurist conference, no less—advance the
theory that DNA and protein are the only molecules that can support self-replication.
Likewise, many people seem to believe that the functionality of life, the
way it solves problems, is somehow inherently better than engineering: that
life can do things inaccessible to engineering, and the best we can do is
to copy its techniques. Any engineering design that does not use all the techniques
of biology is considered to be somehow lacking.
If we see people scraping and painting a bridge to avoid rust, we may think
how much better biology is than engineering: the things we build require maintenance,
while biology can repair itself. Then, when we see a remora cleaning parasites
off a shark, we think again that biology is better than engineering: we build
isolated special-purpose machines, while biology develops webs of mutual support.
But in fact, the remora is performing the same function as the bridge painters.
If we want to think that biology is better, it's easy to find evidence. But
a closer look shows that in many cases, biology and engineering already use
the same techniques.
Biology does use some techniques that engineering generally does not. Because
biology develops by trial and error, it can develop complicated and finely-tuned
interactions between its components. A muscle contracts when it's signaled
by nerves. It also plays a role in maintaining the proper balance of nutrients
in the blood. It generates heat, which the body can use to maintain its temperature.
And the contraction of muscles helps to pump the lymph. A muscle can do all
this because it is made of incredibly intricate cells, and embedded in a tightly-integrated
body. Engineered devices tend to be simpler, with one component performing
only one function. But there are exceptions. The engine of your car also warms
the heater. And the electricity that it generates to run its spark plugs and
fuel pump also powers the headlights.
Complexity deserves a special mention. Many non-engineered systems are complex,
while few engineered systems are. A complex system is one where slightly different
inputs can produce radically different outputs. Engineers like things simple
and predictable, so it's no surprise that engineers try to avoid complexity.
Does this mean that biology is better? No, biology usually avoids complexity
too. Even complex systems are predictable some of the time—otherwise,
they'd be random. Biology is full of feedback loops with the sole function
of keeping complex systems from running off the rails. And it's not as though
engineered devices are incapable of using complexity. Turbulence is complex.
And turbulence is a great way to mix substances together. Your car's engine
is finely sculpted to create turbulence to mix the fuel and the air.
Biology flirts with complexity in a way that engineering does not. Protein
folding, in which a linear chain of peptides folds into a 3D protein shape,
is complex. If you change a single peptide in the protein, it will often fold
to a very similar shape—but sometimes will make a completely different
one. This is very useful in evolving systems, because it allows a single system
to produce both small and large changes. But we like our products to be predictable:
we would not want one in a thousand cars sold to have five wheels, just so
we could test if five was better than four. Evolution is beginning to be used
in design, but it probably will never be used in the manufacture of final
products.
Copying the techniques of life is called biomimesis. There's nothing wrong
with it, in moderation. Airplanes and birds both have wings. But airplane
wings do not have feathers, and airplanes do not digest seeds in mid-air for
fuel. Biology has developed some techniques that we would do well to copy.
But human engineers also have developed some techniques that biology never
invented. And many of biology's techniques are inefficient or simply unnecessary
in many situations. Sharks might not need remoras if they shed their skin
periodically, as some trees and reptiles do.
The design of nanomachines and nanosystems has been a focus of controversy.
Many scientists think that nanomachines should try to duplicate biology: that
the techniques of biology are the best, or even the only, techniques that
can work at the nanometer scale. Certainly, the size of a device will have
an effect on its function. But the device's materials also have an effect.
The materials of biology are quite specialized. Just a few chemicals, arranged
in different patterns, are enough to make an entire organism. But organic
chemicals are not the only kind of chemicals that can make nanoscale structures.
Organics are not very stiff; they vibrate and even change shape. They float
in water, and the vibrations move chemicals through the water from one reaction
site to another.
A few researchers have proposed building systems out of a different kind of
chemistry and machinery. Built of much stiffer materials, and operating in
vacuum or inert gas rather than water, it would be able to manufacture substances
that biology cannot, such as diamond. This has been widely criticized: how
could stiff molecular machines work while fighting the vibrations that drive
biological chemicals from place to place? But in fact, even in a cell, chemicals
are often actively transported by molecular motors rather than being allowed
to diffuse randomly. And even the stiff machine designs use vibration when
it is helpful; for example, a machine designed to bind and move molecules
might jam if it grabbed the wrong molecule, and Drexler has calculated that
thermal noise could be effective at un-jamming it. (See Nanosystems,
section 13.2.1.d.)
Engineering and biology alike are very good at ignoring effects that are irrelevant
to their function. Engineers often find it easier to build systems a little
bit more robustly, so that no action is necessary to keep them working as
designed in a variety of conditions. Biology, being more complicated and delicate,
often has to actively compensate or resist things that would disrupt its systems.
So for the most part, stiff machines would not 'fight' vibrations—they'd
simply ignore them.
Biology still has a few tricks we have not learned. Embryology, immunology,
and the regulation of gene expression still are largely mysterious to us.
We have not yet built a system with as much complexity as an insect, so we
cannot know whether there are techniques we haven't even noticed yet that
help the insect deal with its environment effectively. But even with the tricks
we already know, we can build machines far more powerful—for limited
applications—than biology could hope to match. (How many horses would
fit under the hood of a 300-horsepower sports car?) These tricks and techniques,
with suitable choices and modifications, will work fine even at the molecular
scale. Engineering and biology techniques overlap substantially, and engineering
already has enough techniques to build complete machine systems—even
self-contained manufacturing systems—out of molecules. This may be threatening
to some people who would rather see biology retain its mystery and preeminence.
But at the molecular level, biology is just machines and structures.
C-R-Newsletter #19 May 25, 2004
CONTENTS
Chris goes to China
Mike goes to California
Mark Modzelewski goes...
CRN publishes list of essential study topics
Mike interviewed on Changesurfer Radio
CRN appoints Special Associates
Reminder to join C-R-Network
Feature essay: The Bugbear of Entropy
------------
The World High Technology Society invited me (Chris Phoenix) to China for a week for their Life Spring Forum conference in Dalian and a subsequent speaking tour in Hangzhou and Shanghai. The trip was quite productive and interesting; I made some good contacts and got a better feel for China's technological progress.
The trip wasn't quite what I expected. For one thing, they treated me (along with the other foreign speakers) as a VIP, not just a conference speaker. We met with government officials, had our picture taken with dozens of people, were taken on sightseeing tours, and were fed like a cruise ship.
My first afternoon in Dalian, I gave an interview for the Dalian Daily through a translator. The interviewer appeared to have at least some questions prepared; the translator referred to a printed sheet (in Chinese) for some of the questions. But I had plenty of opportunity to talk about not only the technical aspects of molecular manufacturing, but also the policy implications. I gave special emphasis to the danger that concerns me most: military competition between nations leading to unstable arms race and disastrous war. Several (perhaps all) of the other speakers were interviewed as well, and I haven't seen the article.
For a variety reasons, I was unable to hear most of the talks in the conference. But the nanotech session went very well. At the last minute, the conference organizer had to do something else, so I MC'd the session as well as giving the first talk. The audience asked good questions of each speaker—questions that showed they'd been listening. At the banquet-style dinner that night (did I mention they fed us well?), I got a plaque declaring me an honorary member of the WHTS. Below is a picture of me in a suit—a very rare occurrence—with Dong Qin, Neil Branda, and Mark DiIorio, the other speakers in the nanotech session. I'm told my talk was well-received and I did a very professional job of running the session.
We visited a research center in Dalian, another in Hangzhou, and two in Shanghai. I was too jet-lagged to see much in the Dalian center, and the Hangzhou visit was pretty quick. But the Shanghai visits were very informative. At the Shanghai Institute of Microsystem and Information Technology, I gave a talk on "Advanced Nanotechnology and Human Rights" to perhaps 20 people. I'm told there were some government policy people in the room, but I didn't get a chance to speak with them. Then I got to tour a MEMS research cleanroom of 1800 square meters, with all the equipment needed to build two-inch wafers. I didn't learn much that was new, but it was great fun!
I did speak with scientists, there and at the second research center, attached to Shanghai Jiaotong University, where I gave a more technical talk—basically the talk I had prepared for the conference. (I didn't know I'd be giving that talk until the previous day.) The team there was working on a project to cut single strands of DNA with an atomic force microscope, pick up single fragments on the AFM tip, and analyze them. I thought this was pretty cool work—and it shows that they are using modern tools to do up-to-date research. I was able to suggest a method for detecting whether they had successfully picked up the DNA fragment; I haven't heard yet if my suggestion works. My impression of that team was that they felt more like a startup than like a university research lab. There was a strong sense of purpose, energy, and competence; a sense of 'Let's get this working so we can do the next thing.'
After each of my talks, in the discussion period, someone asked about the Drexler-Smalley debate. I told them what I thought: that Smalley was talking outside his field, that he was wrong about the capabilities of enzymes, that his position is looking weaker all the time, and that his position is motivated by a desire to debunk grey goo.
I asked a couple of questions about work that might be relevant to molecular manufacturing. The answer was: We're not doing that here, but maybe in Beijing. I got the impression that Beijing is where the cutting-edge research happens. So I didn't see any specific indication that China is working on molecular manufacturing, but I doubt that I would have seen it.
After the talk at the conference in Dalian, one professor gave me a tentative invitation to return to China next April, and another person suggested to me that CRN might work with Chinese universities on nanotech policy research. And a researcher in Shanghai told me that his research direction had been inspired in part by Eric Drexler's book Nanosystems. I'll be keeping in touch with these people, as well as others.
I was a bit off-balance with the city officials that we met, but all that seemed to be required was formality; they didn't ask me about nanotech. But I felt right at home with the researchers and students. I don't know if that's because they are Westernized or because I'm used to working with Easterners from my former software career in California. But my take-away impression is that at least some of China's research is fully modern in tools, topics, and attitude.
The Foresight Institute's annual Senior Associates Gathering is a unique event. I (Mike Treder) have never experienced anything quite like it, and I've attended dozens of conferences over the last 25 years. What makes it special is the impressive collection of progress-oriented thinkers—including world-class scientists and engineers, educators, writers, venture capitalists, entrepreneurs, and social activists—all gathered in one place. The event is designed to be informal, with lots of open dialogue encouraged, which is refreshing. But the organizers did a great job of staying on schedule and keeping the sessions flowing smoothly from one into another. Kudos to Foresight President Christine Peterson and her talented staff!
There were numerous people there that I had the opportunity to meet in person for the first time: scientists like Ralph Merkle, Robert Freitas, and J. Storrs (Josh) Hall; Neil Jacobstein, Chairman of the Institute for Molecular Manufacturing; Luke Nosek, founder of PayPal; Brad Templeton, Chairman of the Electronic Frontier Foundation; and Steve Jurvetson, Managing Director of Draper Fisher Jurvetson.
I also renewed acquaintances with great minds like Ramez Naam, CEO of Apex NanoTechnologies; Eliezer Yudkowsky, Research Fellow at the Singularity Institute for Artificial Intelligence; Wrye Sententia, co-director of the Center for Cognitive Liberty & Ethics; and, of course, K. Eric Drexler, founder of the Foresight Institute.
It was a pleasant surprise to discover that CRN is quite well known and respected within the Foresight community. My opinion was often sought during group discussions and many references were made to the important work that CRN is doing.
Some of the talks and breakout sessions concerned technical advancements, but most were focused on the societal implications and policy issues associated with molecular manufacturing. I had the privilege of delivering the final plenary presentation, on the topic of "Challenges of Nanotechnology".
During my presentation, I mentioned a group in Russia that is building powerful instruments and promoting the development of molecular nanotechnology. Several people wanted to know where to find more information about this, so here is the page that describes their "Nanotechnological System".
Many attendees told me they enjoyed my speech, but not everyone was convinced that the challenges of nanotechnology would require the kind of international cooperative administration recommended by CRN. Naturally I did not expect complete agreement, and I'm pleased to have had the opportunity to present our concerns to such a large and potentially influential audience.
Mark Modzelewski, co-founder of the U.S. NanoBusiness Alliance, is now leaving it. During his stay there, he was a vociferous opponent of molecular manufacturing. He denied that a study of molecular manufacturing had been deliberately removed from the 21st Century Nanotechnology Research and Development Act—while Howard Lovy was documenting that the NanoBusiness Alliance had indeed done so. And then, as we noted back in C-R-Newsletter #16, Modzelewski insulted Glenn Reynolds, a respected techno-blogger, for daring to write about molecular manufacturing.
Modzelewski will be going to the newly-formed Lux Research, a nanotech business advisory firm. We may hope that the NanoBusiness Alliance will now be more willing to discuss the possibilities and implications of molecular manufacturing (or at least be more civil and constructive in their disagreement), and that Modzelewski will do less damage to the discussion as one voice among many.
CRN publishes list of essential study topics
CRN has published a list of what we believe currently are the most essential topics for study in the field of responsible nanotechnology. It is a long list: thirty studies, each with several sub-questions. About half of the studies are technical, investigating the capabilities of various proposed kinds of molecular manufacturing. The other half investigate the policy implications of molecular manufacturing and its products.
CRN believes that these studies should be an urgent priority—not done sequentially, but in parallel. To demonstrate the urgency, we have supplied initial answers to each sub-question. The entire file of questions and answers is now available on our website. Mike showed the list to several people at the Foresight Gathering, and reports that they were impressed.
Mike interviewed on Changesurfer Radio
On May 1, Mike was interviewed by James Hughes of Changesurfer Radio. Among other things, they discussed CRN’s concerns about excessive media focus on “grey goo” and comparatively little on other, more imminent and more serious issues such as a nanotech arms race.
A year ago, Chris was interviewed for the same program.
CRN appoints Special Associates
CRN has appointed two Special Associates. Russell Brand is our Strategist on Social Response. Russell's work focuses on appropriate use of technologies in common and complex situations. He is also advising us on how to present our message most effectively.
Tom Cowper is our Special Representative on Governmental Affairs and Homeland Security. Tom is a 21-year law enforcement veteran; works on technologies for policing, public safety and homeland security applications; and writes and speaks about the implications of emerging technology on law enforcement, government, and society.
CRN is very pleased to recognize the ongoing and major contributions of Russell and Tom.
The C-R-Newsletter now has over 500 subscribers, but fewer than 100 of you have taken the next step and joined the C-R-Network. The Network is for people who are motivated to help us prepare for advanced nanotechnology, whether with money, contacts, research, or in any other way. Even if you don't think you have anything to contribute—please let us know that you'd like to help. Sign up here.
Feature essay: The Bugbear of Entropy
by Chris Phoenix, CRN Director of Research
Entropy and thermodynamics are often cited as a reason why diamondoid mechanosynthesis can't work. Supposedly, the perfection of the designs violates a law of physics that says things always have to be imperfect and cannot be improved.
It has always been obvious to me why this argument was wrong. The argument would be true for a closed system, but nanomachines always have an energy source and a heat sink. With an external source of energy available for their use, they can certainly build near-perfect structures without violating thermodynamics. This is clear enough that I've always assumed that people invoking entropy were either too ignorant to be critics, or willfully blind.
It appears I was wrong. Not about the entropy, but about the people. Consider John A. N. (JAN) Lee. He's a professor of computer science at Virginia Tech, has been vice president of the Association for Computing Machinery, has written a book on computer history, etcetera. He's obviously intelligent and well-informed. And yet, he makes the same mistake about entropy--not in relation to nanotech, but in relation to Babbage, who designed the first modern computer in the early 1800's.
In Lee's online history of Babbage, he asserts, "the limitations of Newtonian physics might have prevented Babbage from completing any Analytical Engine." He points out that Newtonian mechanics has an assumption of reversibility, and it wasn't until decades later that the Second Law of Thermodynamics was discovered and entropy was formalized. Thus, Babbage was working with an incomplete understanding of physics.
Lee writes, "In Babbage's design for the Analytical Engine, the discrete functions of mill (in which 'all operations are performed') and store (in which all numbers are originally placed, and, once computed, are returned) rely on this supposition of reversibility." But, says Lee, "information cannot be shuttled between mill and store without leaking, like faulty sacks of flour. Babbage did not consider this, and it was perhaps his greatest obstacle to building the engine."
Translated into modern computer terms, Lee's statement reads, "Information cannot be shuttled between CPU and RAM without leaking, like faulty sacks of flour." The fact that my computer works as well as it does shows that there's something wrong with this argument.
In a modern computer, the signals are digital; each one is encoded as a voltage in a wire, above or below a certain threshold. Transistors act as switches, sensing the incoming voltage level and generating new voltage signals. Each transistor is designed to produce either high or low voltages. By the time the signal arrives at its destination, it has indeed "leaked" a little bit; it can't be exactly the same voltage. But it'll still be comfortably within the "high" or "low" range, and the next transistor will be able to detect the digital signal without error.
This does not violate thermodynamics, because a little energy must be spent to compensate for the uncertainty in the input signal. In today's designs, this is a small fraction of the total energy required by the computer. I'm not even sure that engineers have to take it into account in their calculations, though as computers shrink farther it will become important.
In Babbage's machine, information would move from place to place by one mechanism pushing on another. Now, it's true that entropy indicates a slightly degraded signal--meaning that no matter how precisely the machinery was made, the position of the mechanism must be slightly imprecise. But a fleck of dust in a bearing would degrade the signal a lot more. In other words, it didn't matter whether Babbage took entropy into account or even knew about it, as long as his design could tolerate flecks of dust.
Like a modern computer, Babbage's machine was designed to be digital. The rods and rotors would have distinct positions corresponding to encoded numbers. Mechanical devices such as detents would correct signals that were slightly out of position. In the process of correcting the system, a little bit of energy would be dissipated through friction. This friction would require external energy to overcome, thus preserving the Second Law of thermodynamics. But by including mechanisms that continually corrected the tiny errors in position caused by fundamental uncertainty (along with the much larger errors caused by dust and wear), Babbage's design would never lose the important, digitally coded information. And, as in modern computers, the entropy-related friction would have been vastly smaller than friction from other sources.
Was Babbage's design faulty because he didn't take entropy into account? No, it was not. Mechanical calculating machines already existed, and worked reliably. Babbage was an engineer; he used designs that worked. There was nothing very revolutionary in the mechanics of his design. He didn't have to know about atoms or quantum mechanics or entropy to know that one gear can push another gear, that there will be some slop in the action, that a detent can restore the signal, and that all this requires energy to overcome friction. Likewise, the fact that nanomachines cannot be 100% perfect 100% of the time is no more significant than the quantum-mechanical possibility that part of your brain will suddenly teleport itself elsewhere, killing you instantly.
Should Lee have known that entropy was not a significant factor in Babbage's designs, nor any kind of limitation in their effectiveness? I would have expected him to realize that any digital design with a power supply can beat entropy by continually correcting the information. After all, this is fundamental to the workings of electronic computers. But it seems Lee didn't extend this principle from electronic to mechanical computers.
The point of this essay is not to criticize Lee. There's no shame in a scientist being wrong. Rather, the point is that it's surprisingly easy for scientists to be wrong, even in their own field. If a computer scientist can be wrong about the effects of entropy on an unfamiliar type of computer, perhaps we shouldn't be too quick to blame chemists when they are likewise wrong about the effects of entropy on nanoscale machinery. If a computer scientist can misunderstand Babbage's design after almost two centuries, we shouldn't be too hard on scientists who misunderstand the relatively new field of molecular manufacturing.
But by the same token, we must realize that chemists and physicists talking about molecular manufacturing are even more unreliable than computer scientists talking about Babbage. Despite the fact that Lee knows about entropy and Babbage did not, Babbage's engineering was more reliable than Lee's science. How true it is that "A little learning is a dangerous thing!"
There are several constructive ways to address this problem. One is to continue working to educate scientists about how physics applies to nanoscale systems and molecular manufacturing. Another is to educate policymakers and the public about the limitations of scientific practice and the fundamental difference between science and engineering. CRN will continue to pursue both of these courses.
C-R-Newsletter #18 April 29, 2004
CONTENTS
Slashdot Does CRN
CRN Busy-ness
The new C-R-Network
Blog improvement suggestions?
Tell us about enabling tech!
Feature essay: Science vs. Engineering vs.
Theoretical Applied Nanotechnology
------------
Slashdot.org is a large techie news
blog. CRN was featured on their front page today. Many of the 650 comments
posted to the
article show that readers are aware of the power and the problems created
by molecular manufacturing. Now we just have to get the news to nanotech
policymakers!
Mike and Chris are both very busy with CRN activities, as well as other pesky aspects of real life that keep intruding. Chris, for example, is in the process of moving this week to a new home in Miami. For his part, Mike spent four days last week in England at a Board of Directors retreat for another NGO that he works with. But no complaints; we both love our lives and our work.
Speaking of work, we’re both laboring mightily to prepare for important conference activities next month on behalf of CRN. As we’ve told you before, Chris will be jetting to China in mid-May to give a talk at the World High Technology Society's Life Spring Forum in Dalian. Following that conference, he will give talks in Nanjing on progress toward molecular manufacturing, and in Shanghai on advanced nanotechnology and human rights.
While Chris is in China, Mike will be in California for the Foresight Institute's Senior Associates Gathering, where he has been invited to be a featured speaker. Perhaps some of you will be there to meet him and hear his talk. Here is the abstract:
The challenges brought by advanced nanotechnology will have to be addressed by a diverse collection of people and organizations. No single approach will solve all problems or address all needs. The only answer is a collective answer, and that will demand an unprecedented collaboration of leaders in science, technology, business, government, and NGOs. It will require participation from people of many nations, cultures, languages, and belief systems. Never before has the world faced such a tremendous opportunity—and never before have the risks been so great. We must begin now to develop common understanding, create lines of communication, and build a stable structure that will enable humankind to pass safely through the transition into the nano era.
By the way, the Foresight Institute has extended a nice offer to CRN supporters.
They will give C-R-Newsletter readers a discount of $200 off the standard
fee to join Foresight and register for the Senior Associates conference. Visit this
page to register at the long-expired "Super Early" rate and put "CRN" in
the comments field.
Since our founding in December 2002, CRN has experienced significant growth.
People often tell us how impressed they are by all that we’ve accomplished
in a short time. It’s nice to hear such things, of course, because sometimes
when one is so close to the actual work, it’s hard to appreciate how
much progress is being made.
Some members of our Board of Advisors have
told us that we should prepare ourselves for even faster growth. Evidently
these people, who have more experience in startup organizations than we do,
can sense that CRN is nearing a “tipping point”, and that things
will start moving even faster for us.
A piece of advice they have offered is that we need to be more proactive about
developing a strong working network of supporters, researchers, and potential
collaborators. As such, we’ve decided to form the C-R-Network,
and we want you to join! If you’re interested in being a part of the
solution, please click on the link above.
As most of you know, we started a weblog in January 2004 called Responsible
Nanotechnology. Response has been great. We’re averaging well
over 300 hits per day and we get three to four times as many posted comments
as we make blog entries. But everything can be improved, right?
If you are a regular reader of the blog, please tell us what we can do to
improve it. We think it’s an important way to stay in touch with our
constituency, and the feedback we get to our ideas is truly helpful. So tell
us how we can make it more useful or interesting to you. And if you’re
not a regular reader of the blog, maybe you should be!
One of the things that indicates CRN was founded at the right time (not a
moment too soon, and we hope not too late!) is the rapid development we’re
seeing in enabling technologies. From nanoscale lasers to dip-pen lithography,
and from nanoscale fasteners to nucleic acid building blocks, the molecular
manufacturing toolbox is filling up rapidly.
It’s very important for us to keep abreast of these developments. We’ve
got our ears close to the ground, but if you come across something you think
we should know about, please tell us. Perhaps you work in a field that is
doing relevant work, or maybe you’ve just read something that we didn’t
catch. In any case, don’t hesitate to email Mike or Chris with
new information.
Science vs. Engineering vs. Theoretical Applied Nanotechnology
by Chris Phoenix, CRN Director of Research
When scientists want an issue to go away, they are as political as anyone
else. They attack the credentials of the observer. They change the subject.
They build strawman attacks, and frequently even appear to convince themselves.
They form cliques. They tell their students not to even read the claims, and
certainly not to investigate them. Each of these tactics is being used against
molecular manufacturing.
When facing a scientific theory they disagree with, scientists are supposed
to try to disprove it by scientific methods. Molecular manufacturing includes
a substantial, well-grounded, carefully argued, conservative body of work.
So why do scientists treat it as though it were pseudoscience, deserving only
political attack? And how should they be approaching it instead? To answer
this, we have to consider the gap between science and engineering.
Scientists do experiments and develop theories about how the world works.
Engineers apply the most reliable of those theories to get predictable results.
Scientists cannot make reliable pronouncements about the complex "real world" unless
their theory has been field-tested by engineering. But once a theory is solid
enough to use in engineering, science has very little of interest to say about
it. In fact, the two practices are so different that it's not obvious how
they can communicate at all. How can ideas cross the gap from untested theory
to trustworthy formula?
In Appendix A of Nanosystems,
Eric Drexler describes an activity he calls "theoretical applied science" or "exploratory
engineering". This is the bridge between science and engineering. In theoretical
applied science, one takes the best available results of science, applies
them to real-world problems, and makes plans that should hopefully work as
desired. If done with enough care, these plans may inspire engineers (who
must of course be cautious and conservative) to try them for the first time.
The bulk of Appendix A discusses ways that theoretical applied science can
be practiced so as to give useful and reliable results, despite the inability
to confirm its results by experiment:
For example, all classes of device that would violate the second law of thermodynamics can immediately be rejected. A more stringent rule, adopted in the present work, rejects propositions if they are inadequately substantiated, for example, rejecting all devices that would require materials stronger than those known or described by accepted physical models. By adopting these rules for falsification and rejection, work in theoretical applied science can be grounded in our best scientific understanding of the physical world.
Drexler presents theoretical applied science as a way of studying things
we can't build yet. In the last section, he ascribes to it a very limited
aim: "to describe lower bounds to the performance achievable with physically
possible classes of devices." And a limited role: "In an ideal world, theoretical
applied science would consume only a tiny fraction of the effort devoted to
pure theoretical science, to experimentation, or to engineering." But here
I think he's being too modest. Theoretical applied science is really the only
rigorous way for the products of science to escape back to the real world
by inspiring and instructing engineers.
We might draw a useful analogy: exploratory engineers are to scientists as
editors are to writers. Scientists and writers are creative. Whatever they
produce is interesting, even when it's wrong. They live in their own world,
which touches the real world exactly where and when they choose. And then
along come the editors and the exploratory engineers. "This doesn't work.
You need to rephrase that. This part isn't useful. And wouldn't it be better
to explain it this way?" Exploratory engineering is very likely to annoy and
anger scientists.
To the extent that exploratory engineering is rigorously grounded in science,
scientists can evaluate it -- but only in the sense of checking its calculations.
An editor should check her work with the author. But she should not ask the
author whether he thinks she has improved it; she should judge how well she
did her job by the reader's response, not the writer's. Likewise, if scientists
cannot show that an exploratory engineer has misinterpreted (misapplied) their
work or added something that science cannot support, then the scientists should
sit back and let the applied engineers decide whether the theoretical engineering
work is useful.
Molecular manufacturing researchers practice exploratory engineering: they
design and analyze things that can't be built yet. These researchers have
spent the last two decades asking scientists to either criticize or accept
their work. This was half an error: scientists can show a mistake in an engineering
calculation, but the boundaries of scientific practice do not allow scientists
to accept applied but unverified results. To the extent that the results of
theoretical applied science are correct and useful, they are meant for engineers,
not for scientists.
Drexler is often accused of declaring that nanorobots will work without ever
having built one. In science, one shouldn't talk about things not yet demonstrated.
And engineers shouldn't expect support from the scientific community -- or
even from the engineering community, until a design is proved. But Drexler
is doing neither engineering nor science, but something in between; he's in
the valuable but thankless position of the cultural ambassador, applying scientific
findings to generate results that may someday be useful for engineering.
If as great a scientist as Lord Kelvin can be wrong about something as mundane
and technical as heavier-than-air flight, then lesser scientists ought to
be very cautious about declaring any technical proposal unworkable or worthless.
But scientists are used to being right. Many scientists have come to think
that they embody the scientific process, and that they personally have the
ability to sort fact from fiction. But this is just as wrong as a single voter
thinking he represents the country's population. Science weeds out falsehood
by a slow and emergent process. An isolated scientist can no more practice
science than a lone voter can practice democracy.
The proper role of scientists with respect to molecular manufacturing is to
check the work for specific errors. If no specific errors can be found, they
should sit back and let the engineers try to use the ideas. A scientist who
declares that molecular manufacturing can't work without identifying a specific
error is being unscientific. But all the arguments we've heard from scientists
against molecular manufacturing are either opinions (guesses) or vague and
unsupported generalities (hand-waving).
The lack of identifiable errors does not mean that scientists have to accept
molecular manufacturing. What they should do is say "I don't know," and wait
to see whether the engineering works as claimed. But scientists hate to say "I
don't know." So we at CRN must say it for them: No scientist has yet
demonstrated a substantial problem with molecular manufacturing; therefore,
any scientist who says it can't work probably is behaving improperly and should
be challenged to produce specifics.
C-R-Newsletter #17 March 25, 2004
CONTENTS
Questions for Our Readers: 1) CRN Membership
and Support; 2) Politics
Predictions of Rapid Nanotech Development
Conference Report: Imaging and Imagining Nanoscience
and Engineering, USC
More about Chris's China Trip
Book Report: America as Empire, by Jim Garrison
Science and Technology: The Power of Molecular
Manufacturing
------------
Questions for Our Readers
1) Membership and Support: CRN has never been a membership organization. But
recently we have been talking about whether and, if so, how to change that.
Several options have come up, including paid membership, voluntary sponsorship
or donations (though people can already donate), and a statement of nano responsibility
that people or groups could sign in a show of support to CRN. Which of these
options would you want to participate in?
2) Politics: Full-scale molecular manufacturing might be developed within
the next two U.S. Presidential terms (by 2012). Should nanotech be a political
issue in this election campaign? If Bush or Kerry challenged each other on
U.S. preparation for molecular manufacturing, would you switch channels or
would you pay attention? In this election year, does CRN have any hope of
making nanotech a public issue, or should we wait until after the election?
We say this every time, and no one ever answers, but this time we mean it:
Please tell us what you think about these questions!
------------
Predictions of Rapid Nanotech Development
Seems like every day, there's a new discovery of something that brings molecular
manufacturing closer: a new molecular motor, a new imaging technique, a new
small size record for lithography...
For more than a decade, Chris has been periodically estimating the difficulty
of developing molecular manufacturing. He's recently noticed a pattern: like
the cost of computers, his estimate of development cost has been falling by
half every 2-3 years. That means that if developing molecular manufacturing
would cost $1 billion today, by 2020 it could cost less than $10 million.
If a crash development program were funded, how long would it take? At a guess,
the shortest time is five years: a year to get off the ground and do preliminary
studies, a year to get research under way and find early problems, two years
of all-nighters in the lab, and a final year to put the pieces together. Design
software could be written in parallel, enabling the rapid development of products.
This is a very aggressive schedule, but the Manhattan Project took only three
years.
How much would it actually cost? At this point, there's no way to know for
sure. Two years ago, Chris thought that it would take 10,000 researchers to
do it in five years. Now he thinks perhaps as few as 1,000-2,000 could do
it. Progress has been that rapid!
At this point, the main barrier is conceptual, not financial or scientific.
Someone will develop it -- may already be working on it -- while most other
people remain clueless and unprepared. This seems dangerous. CRN’s job
is to raise awareness of the possibilities. Who do you think most needs to
know about this? What can you do to inform them?
------------
Conference Report: Imaging and Imagining Nanoscience and
Engineering, USC
Chris and Mike met at USC's
conference in Columbia, South Carolina, in the first week of March.
The conference was largely about how to present nanoscale technology, rather
than the technology itself. It's an interesting problem if you stop and
think about it: How do you make an honest image of something too small to
reflect light? All the pretty photos we've seen of nanoscale things are
actually extrapolations from non-optical data.
Eric Drexler (who's on CRN's Board of Advisors)
gave the keynote speech. He aggressively attacked the National Nanotechnology
Initiative for suppressing and denying molecular manufacturing, and said that
Mike Roco, the head of the NNI, had opposed his being invited to speak at
the conference. Though CRN's style is to discuss rather than attack, we hope
that Eric will be successful in drawing attention to the NNI's unfounded dismissal
of molecular manufacturing.
For Mike's view of the conference, see our Responsible Nanotechnology blog
entry.
------------
In May, Chris will be spending a week in China. He will give a talk at the World High Technology Society's Life Spring Forum in Dalian. Not only that, he is organizing a plenary session on nanotechnology. He has a great lineup of speakers, including both researchers and entrepreneurs. After the conference he will give talks in Nanjing on progress toward molecular manufacturing, and in Shanghai on advanced nanotechnology and human rights. This is an exciting opportunity for CRN!
------------
Book report: America as Empire, by Jim Garrison
It’s a bit unusual for us to recommend a non-science book, but America
as Empire: Global Leader or Rogue Power is worthy of an exception. Not
only is this book directly relevant to CRN's work, but it's also a fascinating,
educational and thought-provoking read.
The author, Jim Garrison, Founder and President of the State
of the World Forum and the Gorbachev Foundation/USA, suggests that the
United States can articulate a vision of greatness that will lead the rest
of the world into liberal democracy. If American power is to persist, he
says, it must exercise visionary leadership, similar to that of Franklin
Roosevelt and Harry Truman in the creation of the post World War II international
world order. This order, however, which was based on a balance of power
between sovereign nation-states, is now crumbling under the pressures of
globalization, instantaneous communications, persistent international poverty,
terrorism, and U.S. foreign policy itself.
Garrison emphasizes that "world government is not the solution nor is it a
political possibility... The world does not need yet another level of bureaucracy
and more stultifying processes of deliberation." His recommendations for creating "the
next generation of global governance mechanisms" closely parallel CRN's ideas
as outlined in "Three Systems of Action: A Proposed
Application for Effective Administration of Molecular Nanotechnology".
Jim Garrison believes Americans must see their country as a transitional empire,
whose task is not to dominate but to catalyze change that will make obsolete
forever the need for empire. We heartily encourage everyone to read this important
book, not only U.S. citizens but also those affected by the American empire.
------------
Science and Technology: The Power of Molecular Manufacturing
by Chris Phoenix, CRN Director of Research
So what's the big deal about molecular manufacturing? We have lots of kinds
of nanotechnology. Biology already makes things at the molecular level. And
won't it be really hard to get machines to work in all the weirdness of nanoscale
physics?
The power of molecular manufacturing is not obvious at first. This article
explains why it's so powerful -- and why this power is often overlooked. There
are at least three reasons. The first has to do with programmability and complexity.
The second involves self-contained manufacturing. And the third involves nanoscale
physics, including chemistry.
It seems intuitively obvious that a manufacturing system can't make something
more complex than itself. And even to make something equally complex would
be very difficult. But there are two ways to add complexity to a system. The
first is to build it in: to include lots of levers, cams, tracks, or other
shapes that will make the system behave in complicated ways. The second way
to add complexity is to add a computer. The computer's processor can be fairly
simple, and the memory is extremely simple -- just an array of numbers. But
software copied into the computer can be extremely complex.
If molecular manufacturing is viewed as a way of building complex mechanical
systems, it's easy to miss the point. Molecular manufacturing is programmable.
In early stages, it will be controlled by an external computer. In later stages,
it will be able to build nanoscale computers. This means that the products
of molecular manufacturing can be extremely complex -- more complex than the
mechanics of the manufacturing system. The product design will be limited
only by software.
Chemists can build extremely complex molecules, with thousands of atoms carefully
arranged. It's hard to see the point of building even more complexity. But
the difference between today's chemistry and programmable mechanochemistry
is like the difference between a pocket calculator and a computer. They can
both do math, and an accountant may be happy with the calculator. But the
computer can also play movies, print documents, and run a Web browser. Programmability
adds more potential than anyone can easily imagine -- we're still inventing
new things to do with our computers.
The true value of a self-contained manufacturing system is not obvious at
first glance. One objection that's raised to molecular manufacturing is, “Start
developing it -- if the idea is any good, it will generate valuable spin-offs.” The
trouble with this is that 99% of the value may be generated in the last 1%
of the work.
Today, high-tech intricate products like computer chips may cost 10,000 or
even 100,000 times as much as their raw materials. We can expect the first
nanotech manufacturing systems to contain some very high-cost components.
That cost will be passed on to the products. If a system can make some of
its own parts, then it may decrease the cost somewhat. If it can make 99%
of its own parts (but 1% is expensive), and 99% of its work is automated (but
1% is skilled human labor), then the cost of the system -- and its products
-- may be decreased by 99%. But that still leaves a factor of 100 or even
1,000 between the product cost and the raw materials cost.
However, if a manufacturing system can make 100% of its parts, and can build
products with 100% automation, then the cost of duplicate factories drops
precipitously. The cost of building the first factory can be spread over all
the duplicates. A nanofactory, packing lots of functionality into a self-contained
box, will not cost much to maintain. There's no reason (aside from profit-taking
and regulation) why the cost of the factory shouldn't drop almost as low as
the cost of raw materials. At that point, the cost of the factory would add
almost nothing to the cost of its products. So in the advance from 99% to
100% self-contained manufacturing, the product cost could drop by two or three
orders of magnitude. This would open up new applications for the factory,
further increasing its value.
This all implies that a ten billion dollar development program might produce
a trillion dollars of value -- but might not produce even a billion dollars
worth of spin-offs until the last few months. All the value is delivered at
the end of the program, which makes it hard to fund under current American
business models.
A factory that's 100% automated and makes 100% of all its own parts is hard
to imagine. People familiar with today's metal parts and machines know that
they wear out and require maintenance, and it's hard to put them together
in the first place. But as nanoscientists keep reminding us, the nanoscale
is different. Molecular parts have squishy surfaces, and can bend without
breaking or even permanently deforming. This requires extra engineering to
make stiff systems, but diamond (among other possibilities) is stiff enough
to do the job. The squishiness helps when it's time to fit parts together:
robotic assembly requires less precision. Bearing surfaces can be built into
the parts, and run dry. And because molecular parts (unlike metals) can have
every atom bonded strongly in its place, they won't flake apart under normal
loads like metal machinery does.
Instead of being approximately correct, a molecular part will be either perfect
-- having the correct chemical specification -- or broken. Instead of wearing
steadily away, machines will break randomly -- but very rarely. Simple redundant
design can keep a system working long after a significant fraction of its
components have failed, since any machine that's actually broken will not
be worn at all. Paradoxically, because the components break suddenly, the
system as a whole can degrade gracefully, while not requiring maintenance.
It should not be difficult to design a nanofactory capable of manufacturing
thousands of times its own mass before it breaks.
To achieve this level of precision, it's necessary to start with perfectly
identical parts. Such parts do not exist in today's manufacturing universe.
But atoms are, for most purposes, perfectly identical. Building with individual
atoms and molecules will produce molecular parts as precise as their component
atoms. This is a natural fit for the two other advantages described above
-- programmability, and self-contained automated manufacturing. Molecular
manufacturing will exploit these advantages to produce a massive, unprecedented,
almost incalculable improvement over other forms of manufacturing.
C-R-Newsletter #16 February 25, 2004
CONTENTS:
CRN goes...
...to China!
— Chris to speak at conference and on lecture tour.
...to California!
— Mike a featured speaker at Foresight Institute event.
...to South Carolina!
— Mike to present a paper on nanotech terminology at USC conference.
...to Florida!
— Chris presented a paper at IEEE/FIU Nanodevices conference, and got a big surprise.
...to the Internet!
— CRN blog getting 380 hits per day.
Science and Technology: Nucleic Acid Engineering
Chris has been invited to the World High Technology Society's Life Spring Forum in Dalian, China. He will give a talk at the conference on the revolutionary nature of programmable general-purpose molecular manufacturing. Then he'll give talks in Nanjing on progress toward molecular manufacturing, and in Shanghai on advanced nanotechnology and human rights. This will take place in mid-May. Chris is extremely excited to be going to China for the first time, and to have a chance to spread CRN's message to the far side of the world.
While Chris is in China, Mike will be at the Foresight Institute's Senior Associates Gathering in California, where he has been invited to be a featured speaker. Foresight holds the SAG once a year to consider topics that are too far-future for standard conferences... mainly, issues related to molecular manufacturing.
In early March, Mike will present a paper at the University of South Carolina's Conference on Nanoscience & Engineering. The paper will be on the choices CRN has faced about how to refer to our focus: Molecular Nanotechnology? Advanced Nanotechnology? Just plain Nanotechnology? We've settled on Molecular Manufacturing, but the choice wasn't easy.
Last week, Chris presented a talk and a poster at the IEEE/Florida International University conference on Nanoscale Devices and System Integration. The poster was on progress toward molecular manufacturing (a warmup for one of the China talks), and the talk was on performance of precision NEMS, analyzing how much more powerful nanotech will get when we can build with diamond. Both were well received.
At the conference, Chris was repeatedly astonished by the amount of progress that's been made in dealing with the nanoscale. In many ways, it's more engineering than science now. There's still a lot of work to do, but the sense is that nanoscale phenomena are new and useful—but not mysterious. Lithographic techniques that were barely being researched a few years ago are now old hat. And the cutting-edge physics is now about making electrons dance: there are several different ways of making light squeeze along channels that are too small for it, by converting it to electron activity—and back.
A high percentage of people Chris talked with at the conference found nothing strange or impossible about the idea of mechanical chemistry and molecular manufacturing. Some were skeptical, but none of them could clearly articulate a defensible reason. Others said "Not enough information"—a perfectly reasonable position to take. But many said, "Sure, that makes sense." High-level nanotech policy spokesmen continue to claim that molecular manufacturing is impossible, but it looks like they are increasingly out of touch with many of the scientists in the trenches.
Based on the level of achievement, the speed of development, and the matter-of-fact approach to both molecular manufacturing and nanoscale engineering, Chris now believes that molecular manufacturing may be considerably closer than he thought. A targeted U.S. program that started today might finish in less than five years, if it was well managed and well funded. Of course, anyone who has been working on it already could finish sooner than that. We don't have much time left to prepare.
In January, Mike started a CRN blog. He posts interesting stories each day, and most posts spark lots of interesting discussion. The blog is already getting 380 hits per day, and has been pointed to from various other places.
Last month we mentioned Howard Lovy's Small Times story on the Nano Act. Short but sweet, it documents that leaders of the NanoBusiness Alliance lobbied Sen. John McCain to pull all studies of molecular manufacturing from the Act at the last minute.
Apparently Mark Modzelewski, co-founder of the NanoBusiness Alliance, didn't like the publicity. He wrote a piece for Small Times claiming that molecular manufacturing proponents were spinning theories about devious cabals. (Chris will have a nice response published in the next print issue of the magazine, explaining why near-term nanotech boosters ought to welcome studies of molecular manufacturing.)
Then things really heated up. Glenn Reynolds, author of the highly respected InstaPundit site, commented on the story... and Mark insulted him in multiple emails, including a screed about imaginary bugs under a wino's skin. As Dave Barry says, I am not making this up. Looks like the nano nay-sayers are getting desperate.
One of CRN's major goals is to improve the quality of discussion about nanotechnology. We have seen all too many news stories and publications confusing nanoparticles with grey goo, or claiming that molecular manufacturing is impossible for some bogus reason. If you see a story like that, please tell us about it! We will do our best to respond, either by writing a response, helping you write one, or working behind the scenes to educate the author responsible.
Another way you can help us: tell us what you want in the newsletter and
on the CRN website! We don't have time to do everything, but we sure will
try...
SCIENCE AND TECHNOLOGY — by Chris Phoenix
Nucleic Acid Engineering
The genes in your cells are made up of deoxyribonucleic acid, or DNA: a long, stringy chemical made by fastening together a bunch of small chemical bits like railroad cars in a freight train. The DNA in your cells is actually two of these strings, running side by side. Some of the small chemical bits (called nucleotides) like to stick to certain other bits on the opposite string. DNA has a rather boring structure, but the stickiness of the nucleotides can be used to make far more interesting shapes. In fact, there's a whole field of nanotechnology investigating this, and it may even lead to an early version of molecular manufacturing.
Take a bunch of large wooden beads, some string, some magnets, and some small patches of hook-and-loop fastener (called Velcro when the lawyers aren't watching). Divide the beads into four piles. In the first pile, attach a patch of hooks to each bead. In the second pile, attach a patch of loops. In the third pile, attach a magnet to each bead with the north end facing out. And in the fourth pile, attach a magnet with the south end exposed. Now string together with a random sequence of beads—for example,
1) Hook, Loop, South, Loop, North, North, Hook.
If you wanted to make another sequence stick to it, the best pattern would be:
2) Loop, Hook, North, Hook, South, South, Loop.
Any other sequence wouldn't stick as well: a pattern of:
3) North, North, North, South, North, Loop, South
would stick to either of the other strands in only two places.
Make a few dozen strings of each sequence. Now throw them all in a washing machine and turn it on. Wait a few minutes, and you should see that strings 1) and 2) are sticking together, while string 3) doesn't stick to anything. (No, I haven't tried this; but I suspect it would make a great science fair project!)
But we can do more than make the strings stick to each other: we can make them fold back on themselves. Make a string of:
N, N, N, L, L, L, L, H, H, H, H, S, S, S
and throw it in the washer on permanent press, and it should double over. With a more complex pattern, you could make a cross:
NNNN, LLLLHHHH, LNLNSHSH, SSLLNNHH, SSSS
The NNNN and SSSS join, and each sequence between the commas doubles over. You get the idea: you can make a lot of different things match up by selecting a sequence from just four letter choices. Accidental matches of one or two don't matter, because the agitation of the water will pull them apart again. But if enough of them line up, they'll usually stay stuck.
Just like the beads, there are four different kinds of nucleotides in the chain or strand of DNA. Instead of North, South, Hook, and Loop, the nucleotide chemicals are called Adenine, Thiamine, Guanine, and Cytosine, abbreviated A, T, G, and C. Like the beads, A will only stick to T, and G will only stick to C. (You may recognize these letters from the movie GATTACA.) We have machines that can make DNA strands in any desired sequence. If you tell the machine to make sequences of ACGATCTCGATC and TGCTAGAGCTAG, and then mix them together in water with a little salt, they will pair up. If you make one strand of ACGATCTCGATCGATCGAGATCGT—the first, plus the second backward—it will double over and stick to itself. And so on. (At the molecular scale, things naturally vibrate and bump into each other all the time; you don't need to throw them in a washing machine to mix them up.)
Chemists have created a huge menu of chemical tricks to play with DNA. They can make one batch of DNA, then make one end of it stick to plastic beads or surfaces. They can attach other molecules or nanoparticles to either end of a strand. They can cut a strand at the location of a certain sequence pattern. They can stir in other DNA sequences in any order they like, letting them attach to the strands. They can attach additional chemicals to each nucleotide, making the DNA chain stiffer and stronger.
A DNA strand that binds to another but has an end hanging loose can be peeled away by a matching strand. This is enough to build molecular tweezers that open and close. We can watch them work by attaching molecules to the ends that only fluoresce (glow under UV light) when they're close together.
Remember that DNA strands can bind to themselves as well as to each other. And you can make several strands with many different sticky sequence patches to make very complex shapes. Just a few months ago, a very clever team managed to build an octahedron out of only one long strand and five short ones. The whole thing is only 22 nanometers wide—about the distance your fingernails grow in half a minute.
So far, this article has been a review of fact. This next part is speculation. If we can build a pre-designed structure, and make it move as we want, we can—in theory, and with enough engineering work—build a molecular robot. The robot would not be very strong, or very fast, and certainly not very big. But it might be able to direct the fabrication of other, more complex devices—things too complex to be built by pure self-assembly. And there's one good thing about working with molecules: because they are so small, you can make trillions of them for the price of one. That means that whatever they do can be done by the trillions—perhaps even fast enough to be useful for manufacturing large products such as computer chips. The products would be repetitive, but even repetitive chips can be quite valuable for some applications. Individual control of adjacent robots would allow even more complex systems to be built. And with a molecular-scale DNA robot, it might be possible to guide the fabrication of smaller and stiffer structures, leading eventually to direct mechanical control of chemistry—the ultimate goal of molecular manufacturing.
This has barely scratched the surface of what's being done with DNA engineering. There's also RNA (ribonucleic acid) and PNA (peptide nucleic acid) engineering, and the use of RNA as an enzyme- or antibody-like molecular gripper. Not to mention the recent discovery of RNA interference which has medical and research uses: it can fool a cell into stopping the production of an unwanted protein, by making it think that that protein's genes came from a virus.
Nucleic acid engineering looks like a good possibility for building a primitive variety of nanorobotics. Such products would be significantly less strong than products built of diamondoid, but are still likely to be useful for a variety of applications. If this technology is developed before diamondoid nanotech, it may provide a gentler introduction to the power of molecular manufacturing.
If you have any comments or questions about this explanation of nucleic acid engineering, please email Chris Phoenix, CRN's Director of Research.
C-R-Newsletter #15 January 13, 2004
With this issue, we've decided to start something new: after CRN News, you'll find a brief article explaining a technical aspect of advanced nanotechnology. This month, we'll begin with how scientists "see" things smaller than a wavelength of light, with cutting edge sub-wavelength imaging techniques.
CRN NEWS
Happy Birthday to CRN!
We founded CRN sometime in December 2002. We can't agree on the date; Chris
prefers Mike's original email in early December, but Mike thinks we should
count from the website going online, which happened around Christmas. Perhaps
the most official date would be when World
Care agreed to support us in being a non-profit. Anyway, those were
all in December, so we're now one year old.
We've done quite a lot in the last year: published numerous papers and
commentaries, built a prestigious Board of
Advisors, given a presentation to the EPA,
been mentioned in US News and World Report, and had articles republished
on KurweilAI and in Small Times. This year we're going to be even more energetic
and diverse. QUESTION #1: If we started a nano-blog, would you read
it? We'd really like to know. Please let
us know. Thanks!
The Futurist published a great article written by Mike on nanofactories in
its current edition. Small
Times immediately reprinted it. And this led to a request from another
magazine for an article from him, as well as several newsletter signups.
Last month Chris gave his presentation to the
EPA Science Advisory Board. It went very well. Everyone on the panel had only
a few minutes to speak, and if you've been reading our newsletters (of course
you have!) you know that you can't summarize advanced nanotechnology in six
minutes. But he managed to hit most of the highlights. Several people on the
Science Advisory Board told him afterward that they appreciated the talk.
Chris spent the next day talking with several people in Washington, including
a Congressional staffer. All the talks were preliminary, but should lead to
good things in the future.
There are now almost three hundred people on our newsletter list. That's pretty
good! But we'd like to reach more people. QUESTION #2: Would your friends
and co-workers be interested in this newsletter? Why or why not? Could you
take a minute and tell
us what would inspire you to forward this newsletter to them?
The Drexler/Smalley debate has not generated an obvious
shift of opinion one way or the other. It looks like we were over-optimistic
about that. Apparently, in many people's perception, Smalley's incorrect statements
about enzymes weren't enough to weaken his argument. And Smalley and Drexler
both talked past each other — which left each side claiming victory
and ignoring the equally loud victory yells from the other side.
In other nano-establishment news, we're eagerly awaiting Howard Lovy's promised
article on the 21st Century Nano Act and why molecular manufacturing was deliberately
excluded from it. He's promised that once the article comes out, he'll post
additional information on his blog.
At CRN, we’re working on our own activist response to this controversy — can’t
tell you about it yet, but it’s big, and we should be ready to announce
something soon. Stay tuned!
SCIENCE AND TECHNOLOGY — by Chris Phoenix
Sub-wavelength Imaging
Light comes in small chunks called photons, which generally act like waves.
When a drop falls into a pool of water, one or more peaks surrounded by troughs
move across the surface. It's easy to describe a single wave: the curvy shape
between one peak and the next. Multiple waves are just as easy. But what is
the meaning of a fractional wave? Chop out a thin slice of a wave and set
it moving across the water: it would almost immediately collapse and turn
into something else. For most purposes, fractional waves can't exist. So it
used to be thought that microscopes and projection systems could not focus
on a point smaller than half a wavelength. This was known as the diffraction
limit.
There are now more than half a dozen ways to beat the so-called diffraction
limit. This means that we can use light to look at smaller features, and also
to build smaller things out of light-sensitive materials. And this will be
a big help in doing advanced nanotechnology. The wavelength of visible light
is hundreds of nanometers, and a single atom is a fraction of one nanometer.
The ability to beat the diffraction limit gets us a lot closer to using an
incredibly versatile branch of physics—electromagnetic radiation—to
access the nanoscale directly.
Here are some ways to overcome the diffraction limit:
There's a chemical that glows if it's hit with one color of light, but if
it's also hit with a second color, it doesn't. Since each color has a slightly
different wavelength, focusing two color spots on top of each other will create
a glowing region smaller than either spot. READ
MORE
There are plastics that harden if hit with two photons at once, but not if
hit with a single photon. Since two photons together are much more likely
in the center of a focused spot, it's possible to make plastic shapes with
features smaller than the spot. READ
MORE
Now this one is really interesting. Remember what we said about a fractional
wave collapsing and turning into something else? Not to stretch the analogy
too far, but if light hits objects smaller than a wavelength, a lot of fractional
waves are created, which immediately turn into “speckles” or “fringes.” You
can see the speckles if you shine a laser pointer at a nearby painted (not
reflecting!) surface. Well, it turns out that a careful analysis of the speckles
can tell you what the light bounced off of—and you don't even need a
laser. READ
MORE
A company called Angstrovision claims
to be doing something similar, though they use lasers. They say they'll soon
have a product that can image 4x12x12 nanometer features at three frames per
second, with large depth of field, and without sample preparation. And they
expect that their product will improve rapidly.
High energy photons have smaller wavelengths, but are hard to work with. But
a process called “parametric downconversion” can split a photon
into several “entangled” photons of lower energy. Entanglement
is spooky physics magic that even we don't fully understand, but it seems
that several entangled photons of a certain energy can be focused to a tighter
spot than one photon of that energy. READ
MORE
A material's “index of refraction” indicates how much it bends
light going through it. A lens has a high index of refraction, while vacuum
is lowest. But certain composite materials can have a negative index of refraction.
And it turns out that a slab of such material can create a perfect image—not
diffraction-limited—of a photon source. This field is advancing fast:
last time we looked, they hadn't yet proposed that photonic crystals could
display this effect. READ
MORE
A single atom or molecule can be a tiny source of light. That's not new. But
if you scan that light source very close to a surface, you can watch very
small areas of the surface interact with the “near-field effects”.
Near-field effects, by the way, are what's going on while speckles or fringes
are being created. And scanning near-field optical microscopy (SNOM, sometimes
NSOM) can build a light-generated picture of a surface with only a few nanometers
resolution. READ
MORE
Finally, it turns out that circularly polarized light can be focused a little
bit smaller than other types. (Sorry, we couldn't find the link for that one.)
Some of these techniques will be more useful than others. As researchers develop
more and more ways to access the nano-scale, it will rapidly get easier to
build and study nanoscale machines.
If you have any comments or questions about this brief technical explanation, please Chris Phoenix, CRN's Director of Research.
Subscribe to the C-R-Newsletter!
Newsletter Archives: 2008 2007 2006 2005 2003
Inform your communities
Home | About Us | Donate | FAQ | Nano Tomorrows | CRN Blog | Site Map | Contact CRN
Last updated on